In case you care about the different tags on each sequence: 
#!/usr/bin/perl -w

use strict;

my %unique = ( );
while (<DATA>) {
    chomp;
    my ($tag, $sequence) = split;
    next unless defined $tag;
    if (exists $unique{$sequence}) {
        push @{ $unique{$sequence} }, $tag;
    } else {
        $unique{$sequence} = [ $tag ];
    }
}

foreach (keys %unique) {
    print "Sequence: $_\n\tTags:\n";
    foreach my $tag (@{ $unique{$_} }) {
        print "\t$tag\n";
    }
}

__DATA__
>atc:AGR_pTi_39_1-45_FD cctttcaagtcatagaacaccggggcatgtacaacttggggaagg
>atc:AGR_pTi_47_1-45_FD ccttacaggtcattgagcacagaggaatgttcaatttagggaaac
>atc:AGR_pTi_39_1-45_F      cctttcaagtcatagaacaccggggcatgtacaacttgggga
+agg
>atc:AGR_pTi_47_1-45_F      ccttacaggtcattgagcacagaggaatgttcaatttaggga
+aac
>atc:AGR_pTi_39_1-45_RD cctttcaagtcatagaacaccggggcatgtacaacttggggaagg
>atc:AGR_pTi_47_1-45_RD ccttacaggtcattgagcacagaggaatgttcaatttagggaaac
>atc:AGR_pTi_39_1-45_R  cctttcaagtcatagaacaccggggcatgtacaacttggggaagg

[download]
HTH

In reply to Re: extracting duplicates from a list by falsa_utopia
in thread extracting duplicates from a list by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.