Dear monks, I have a string of text and i wnat to acess substrings of it using substr. e.g say I have a string of length 100, i want to access substrings of length 10 whose start positions moves along by 3 positions each time (e.g they are overlapping). I have the basic theory working but can't seem to access the correct length of string, heres my code:

@dna = 'accatgagctgtacgtagcatctgagcgcgcatgactgtgactgacgtaggcagca';
my $dna = join ('', @dna);
my $movement = 3;

for (my $pos = 10; $pos <= @dna; $pos +=$movement+1)  {
     substr ($dna, $pos,0, "\n");
}
                                                                      
+                               
my @windows;
push @windows, $dna;
                                                                      
+                               
print "@windows\n";
[download]

# thanks!

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.