Dear monks, I am a newbie and am getting stuck! All i want to do is given the two arrays below, i want to concatenate all the elements in @seqs which have the same value in @labels and put each newly formed sequence into a new array with each sequence as a new element. Can someone show me what i'm doing wrong? 

my @labels = ('1', '1', '1', '2', '3', '4', '5', '6', '6', '7');

my @seqs = ('a', 'ctgc', 'tggattgactgtg', 'atgcatg' , 'ctgctgcatgtgatg
+actgtg', 'tgatg', 'gtgt', 'gcgccggactatgattgagctagcgtatgctgcatgctgat'
+, 'gggtttttttttttccccccccccc', 
 'aaaaaagggggg');


# where the $labels[0] .. [2] all correspond to number 1, so $seqs[0] 
+.. [2] are concatenated to make actgctggattgactgtg etc.

I have tried the following code but the problem is that if there are t
+hree or more consecutive elements in @labels that have the same value
+, my code only gets the sequences of two in a row, not all of them on
+ce only (meaning that sequences will be redundant).


for (my $i=0; $i< @labels; $i++)  {
      if ($labels[$i] == $labels[$i+1])   {
#                      print "$labels[$i] == $labels[$i+1]\n";
                       push @window_int_seqs, "$seqs[$i]$seqs[$i+1] ";
      }
}

[download]

In reply to two array comparisons by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.