I think the best way to do this is, "USE A HASH": 
#!/usr/bin/perl

use strict;
use warnings;

my @labels = ('1', '1', '1', '2', '3', '4', '5', '6', '6', '7');

my @seqs = ('a', 'ctgc', 'tggattgactgtg', 'atgcatg' ,
 'ctgctgcatgtgatgactgtg', 'tgatg', 'gtgt',
 'gcgccggactatgattgagctagcgtatgctgcatgctgat',
 'gggtttttttttttccccccccccc', 'aaaaaagggggg');

# a useful rule of thumb to remember when programming in Perl:
# can I use a hash to solve this problem?
my %output = ();

if (@labels != @seqs)
{
    die "arrays are different length";
}

for (my $i = 0; $i <= $#labels; $i++)
{
    # concatenate the sequence onto what's already there for this labe
+l
    $output{$labels[$i]} .= $seqs[$i];
}

foreach my $label (sort keys %output)
{
    print "label: $label = $output{$label}\n";
}

__END__

[download]
Output: 
label: 1 = actgctggattgactgtg
label: 2 = atgcatg
label: 3 = ctgctgcatgtgatgactgtg
label: 4 = tgatg
label: 5 = gtgt
label: 6 = gcgccggactatgattgagctagcgtatgctgcatgctgatgggtttttttttttcccc
+ccccccc
label: 7 = aaaaaagggggg

[download]

In reply to Re: two array comparisons by beable
in thread two array comparisons by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.