Thanks for that advice, and I'll follow it up immediately with the script below, which I made after the OP and which is probably indeed bad code, although I think it does give the time discrepancies that I am looking for (qr much faster than eval). I suppose the main thing I missed all along (I had been told things in CB before), is the slowness of eval. Well, now I know :) 

#!/usr/bin/perl -w

use strict;
use warnings;

use Benchmark qw /cmpthese/;

cmpthese 10_000 => {
  'do_eval' =>  sub { do_eval() },
  'do_qr'   =>  sub { do_qr() },
};

sub do_eval {
  my $genome  = "AGTATCGATCGATGCATGCTAGCTAGCTAGCTAGCTAGCTAGSTGCTAGCT";
  my @regexes = ('abc', '^qwerty'); # dont care
  my $count   = 0;
  my $code    = 'if ($genome =~ /' . join ('/ && /', @regexes) . '/) {
+ $count++; }';
  eval $code;
  die "Error: $@\n Code:\n$code\n" if ($@);
}

sub do_qr {
  my $string  = "AGTATCGATCGATGCATGCTAGCTAGCTAGCTAGCTAGCTAGSTGCTAGCT";
  my @regexes = ("abc", "^qwerty");  # dont care
  my $count   = 0;
  my @compiled  = map qr/$_/, @regexes;
  for(my $i=0; $i<@regexes; $i++) {
      if($string =~ /$compiled[$i]/){
          $count++;
      }
  }
}

__END__

          Rate do_eval   do_qr
do_eval 2162/s      --    -77%
do_qr   9242/s    328%      --

[download]

In reply to Re^4: eval string possibilities by erix
in thread eval string possibilities by erix

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.