An important part of making benchmark code is to ensure the alternatives do the same thing. Your do_eval subroutine had a minor problem (you only had =~ $genome on the first match, instead of all of them), which I corrected. But then when I looked at the output from the two subroutines, I noticed it was different:

sub do_eval {
  my $genome  = "AGTATCGATCGATGCATGCTAGCTAGCTAGCTAGCTAGCTAGSTGCTAGCT";
  my @regexes = ('AGT', 'ATC'); # dont care
  my $count   = 0;
  my $code    = 'if ('
              . join(' && ',
                     map { "\$genome =~ /$_/" } @regexes)
              . ') { $count++; }';
  eval $code;
  die "Error: $@\n Code:\n$code\n" if ($@);
  return $count; # returns 1
}

sub do_qr {
  my $string  = "AGTATCGATCGATGCATGCTAGCTAGCTAGCTAGCTAGCTAGSTGCTAGCT";
  my @regexes = ("AGT", "ATC");  # dont care
  my $count   = 0;
  my @compiled  = map qr/$_/, @regexes;
  for(my $i=0; $i<@regexes; $i++) {
      if($string =~ /$compiled[$i]/){
          $count++;
      }
  }
  return $count; # returns 2
}

[download]

To fix that, I changed your do_eval sub to the following:

sub do_eval {
  my $genome  = "AGTATCGATCGATGCATGCTAGCTAGCTAGCTAGCTAGCTAGSTGCTAGCT";
  my @regexes = ('AGT', 'ATC'); # dont care
  my $count   = 0;
  my $code    = join ";",
                map { "\$count++ if \$genome =~ /$_/" } @regexes;
  eval $code;
  die "Error: $@\n Code:\n$code\n" if ($@);
  return $count; # returns 2
}

[download]

And I decided to add my own take on the matter, which generates One Big Regex, rather than a bunch of them:

sub do_genre {
  my $genome  = "AGTATCGATCGATGCATGCTAGCTAGCTAGCTAGCTAGCTAGSTGCTAGCT";
  my @regexes = ("AGT", "ATC");  # dont care
  my $regex   = join "|", map "($_)", @regexes;
  my $count   = () = $genome =~ /$regex/;
  return $count; # returns 2
}

[download]

When I run the benchmark, I get the following results:

             Rate  do_eval    do_qr do_genre
do_eval   15531/s       --     -65%     -90%
do_qr     44671/s     188%       --     -72%
do_genre 157893/s     917%     253%       --

[download]

Which just goes to show that the string eval is slow, but the looping is even slower. A different algorithm makes a big difference.

In reply to Re^5: eval string possibilities by revdiablo
in thread eval string possibilities by erix

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.