Dear all,
My quest is simple, but I am getting into dark and deep waters.
I have 2 files. Both consist of gene sequence lists. One contains whole sequences (a sequence can have 16,000 characters (bases)). The second file contains a list of sequences each with 25 bases (characters). I am trying to find matches of the little sequences inside any part of the big sequences. The first file has about 600 lines. The second has 6680 lines. Each line in both files corresponds to a sequence.
Here is the part of my code that is chocking:
while(<F1>) { # this is the "Biiiiigggg Sequence" $targetseq = $_; print "$targetseq\n"; chomp($targetseq); open(F2,"<$file2") or die "Error opening $file2: $!"; while(<F2>) { # probe sequences (25 base) substr($_,0, 25); $probe = $_; chomp($probe); if ($targetseq=~ /.*$probe.*/) { *this is Line 29 $start = index($targetseq, $probe); push(@matchregion,$start); } } $indexes = @matchregion;
I get the following error:
Unmatched ( in regex; marked by <-- HERE in /.*AGCTCAAAACTCTCAAAGAGGAGG MMUS00S00000022 AJ242777 1427689_a_at "Mus musculus mRNA for ABINs, ( <-- HERE A20-binding inhibitor of NF-kappa B activation (small).".*/ at sequence_coverage.pl line 29, <F2> line 1073.
I am trying to match the second file string to any part of the first file string. I know I am doing something wrong. Any help will be humbly accepted. Thanks!
In reply to Opening files, comparing strings. Should be simple!? by PD
| For: | Use: | ||
| & | & | ||
| < | < | ||
| > | > | ||
| [ | [ | ||
| ] | ] |