Guys.. really appreciate all your help, especially Ovid and QM! First i would like to clear out that this is not my homework.. :) haha

I have try out the 2 script that Ovid and QM provided.. it seems not working for me, or i should give u all a clearer view of the input and the output i needed, i will make it clear on the input format 1st. The output of the trf program will be a text file.

Input:
Tandem Repeats Finder Program writen by: Gary Benson
Department of Biomathematical Sciences
Mount Sinai School of Medicine
Version 3.21

Sequence: contig001
Parameters: 2 7 7 80 10 50 50
506 540 6 2.0 6 100 0 70 42 42 0 14 1.45 AAACCC AAACCAAACCC
664 691 3 9.3 3 100 0 56 32 35 32 0 1.58 CAG CAGCAGCAGCAG
2642 2668 3 9.0 3 100 0 54 0 33 33 33 1.58 CTG CTGCTGCTGCTG

Sequence: contig002
Parameters: 2 7 7 80 10 50 50
128 188 3 20.3 3 80 6 70 34 29 31 4 1.79 GCA GCAGCAGCAGCAA
313 357 3 15.0 3 81 9 56 35 33 28 2 1.70 AGC AGCAGCAGCAGC

let me explain what is the output. First the software will quote a few lines of the author, and following by the output. The identifier for the fisrt line should be "Sequence:" --> because the name of the sequence will always differ depend on the input. Secondly, the output will show the parameters use in the program, but all the parameter should be the same thru out the whole output. thirdly is the information of the repeats. As for the 1st sequence, there are 3 seperate line indicating the information of repeat and 2 for the 2nd sequence. Every line will have 13 numbers and 2 alhabet variable, which is the repeat unit and the consensus sequence..

Output:
Contig001 506 540 6 2.0 6 100 0 70 42 42 0 14 1.45 AAACCC AAACCAAACCC
Contig001 664 691 3 9.3 3 100 0 56 32 35 32 0 1.58 CAG CAGCAGCAGCAG
Contig001 2642 2668 3 9.0 3 100 0 54 0 33 33 33 1.58 CTG CTGCTGCTGCTG
contig002 128 188 3 20.3 3 80 6 70 34 29 31 4 1.79 GCA GCAGCAGCAGCAA
Contig002 313 357 3 15.0 3 81 9 56 35 33 28 2 1.70 AGC AGCAGCAGCAGC

Ok this is the output i needed, So for the above example, i wish to get only 5 lines output. So that i can either import into excel, or even mySql database. Again.. all of your help is higly aprreciated!

P.S -- some of the ouput may give blanks result such as :

Sequence: contig003
Parameters: 2 7 7 80 10 50 50
Sequence: contig004
Parameters: 2 7 7 80 10 50 50
128 188 3 20.3 3 80 6 70 34 29 31 4 1.79 GCA GCAGCAGCAGCAATAGCAGCAG

In reply to Perl Parser, need help by joomanji

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.