dear monks,

i have a very simple problem but can't work it out! I basically have two arrays, one contains a small number of unique id's, the second contains lots of sequences labelled with their id's.

I am simply trying to compare the unique sequence id's to those in the sequence file and extract the corresponding sequence.

I am getting confused trying to loop within two arrays. Please can someone show me where i'm getting it wrong?? 

# the uniq id's file looks like this:
#                                 
gi|11995001:156374-156649                                             
dbj|BA000040|:2701685-2702539                                         
dbj|BA000040|:c8987046-8986282                                        
gi|13488050:58289-58570                                               
gi|13470324:5721573-5721854       

# the corresponding sequence file looks like this:
                 
>gi|11995001:156374-156649, SMa0002
ATGGAGGCTGTTCCCATGAATGTAGACCTCTCACGGCGCAGCTTTTTGAAGCTGGCTGGAGCAGGGGCTG
CGGCAACGTCACTCGGTGCGATGGGGTTTGGTGAGGCTGAGGCGGCGGTCGTCGCGCATGTCCGGCCTCA

>dbj|BA000040|:2701685-2702539
GAAGGAGCCGATCTGGTCACCTTTTCCGGCGACAAGCTGCTGGGCGGTCCGCAGGCGGGTTTCATCGTCG
GGCGCAGGGACCTGATCGCCGA

# every unique_id has a corresonding sequence in @sequence

# here is my attempt
open (GENES, "$ARGV[1]") or die "unable to open file $!\n";


open (IDS, "$ARGV[0]") or die "unable to open file $!\n";
open (GENES, "$ARGV[1]") or die "unable to open file $!\n";

my @ids = <IDS>;
my @genes = <GENES>;

my $ids = join ('', @ids);
@ids = split ('\n', $ids);

my $genes = join ('', @genes);
@genes = split ('>', $genes);

my @accessions;

foreach my $line (@file)        {
        if ($line =~ /^(\w+\|\w+\.{0,1}\d{0,1}\|{0,1}:c{0,1}\d+\-\d+)/
+) {
                push @accessions, "$1";
        }
}
# extract uniq id's

my %seen=();
my @uniq = ();
foreach my $item (@accessions)  {
        unless ($seen{$item})   {
                $seen{$item}=1;
                push (@uniq, $item);
        }
}

# dig out the correspnding sequence for each id
# THIS BIT NOT WORKING ;-(

for (my $i=0; $i<@sequence; $i++)  {
        foreach my $id (@uniq)  {
                if ($sequence[$i] =~ /^$id/)       {
                        print "$id\n";
                }
        }
}

[download]

In reply to pattern matching and array comparison by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.