comment on

On this website. I am attempting to do these two steps:

Set "Start<-ATG" into -450 and "ATG->END" 50, as the value
Click on "Retrieve Sequence" button.

But how come the following script I have doesn't do the job? Especially the "click_button" method.

use WWW::Mechanize;   
my $mech = WWW::Mechanize->new();

my $tf_add = "http://rulai.cshl.edu/cgi-bin/SCPD/getgene2?ARG1";
$mech->get($tf_add); 


$mech->set_fields( 'start' => -450, 'end' => 50 ); # this part works

# but not this:

$mech->click_button( 
        name   => "action",       
        value  => "Retrieve sequence"
);

$mech->submit();

my $result = $mech->content();
print "$result\n";
[download]

The snippet of the HTML structure in the related website can be found here :

<html><title>ARG1</title>
<body bgcolor=white>
<h2 align=center>ARG1</h2><hr>
<form method="post" action="/cgi-bin/SCPD/getgene2?ARG1" enctype="appl
+ication/x-www-form-urlencoded">
<input type="submit" name="action" value="Get mapped sites" /><input t
+ype="submit" name="action" value="Get putative sites" /><input type="
+submit" name="action" value="Get intergenic region" /><br /><input ty
+pe="submit" name="action" value="Retrieve sequence" />Start<-ATG <inp
+ut type="text" name="start" value="-500" size="5" maxlength="5" />ATG
+->End <input type="text" name="end" value="50" size="5" maxlength="5"
+ /><div></div></form><hr>
<pre>
       ORF     YOL058W
      GENE     ARG1
        XX
    FACTOR     <a href= 
                "getfactor?ARC">ARC</a>
COORDINATE     (-269, -247)
  SEQUENCE     CATTTAAAGGCAGGAGAGAGAGA
 REFERENCE     Yeast 1995, 11:1367-1380

.... skip some entries...

</pre>
[download]

And the desired final output looks like this (by hand clicking).

<html><title>ARG1</title>
<body bgcolor=white>
<h2 align=center>ARG1</h2><hr>
<form method="post" action="/cgi-bin/SCPD/getgene2?ARG1" enctype="appl
+ication/x-www-form-urlencoded">
<input type="submit" name="action" value="Get mapped sites" /><input t
+ype="submit" name="action" value="Get putative sites" /><input type="
+submit" name="action" value="Get intergenic region" /><br /><input ty
+pe="submit" name="action" value="Retrieve sequence" />Start<-ATG <inp
+ut type="text" name="start" value="-450" size="5" maxlength="5" />ATG
+->End <input type="text" name="end" value="50" size="5" maxlength="5"
+ /><div></div></form><hr>
<pre>
>YOL058W  ARG1  218759  219259
CGAGCTTTTTCACTGCAGTAATTCTCCACATGGGCCCAGCCACTGAGATA
AGAGCGCTATGTTAGTCACTACTGACGGCTCTCCAGTCATTTATGTGATT
TTTTAGTGACTCATGTCGCATTTGGCCCGTTTTTTTCCGCTGTCGCAACC
TATTTCCATTAACGGTGCCGTATGGAAGAGTCATTTAAAGGCAGGAGAGA
GAGATTACTCATCTTCATTGGATCAGATTGATGACTGCGTACGGCAGATA
GTGTAATCTGAGCAGTTGCGAGACCCAGACTGGCACTGTCTCAATAGTAT
ATTAATGGGCATACATTCGTACTCCCTTGTTCTTGCCCACAGTTCTCTCT
CTCTTTACTTCTTGTATCTTGTCTCCCCATTGTGCAGCGATAAGGAACAT
TGTTCTAATATACACGGATACAAAAGAAATACACATAATTGCATAAAATA
ATGTCTAAGGGAAAAGTTTGTTTGGCTTATTCTGGTGGTTTAGATACCTC
[download]

Finally I would just like to extract the DNA sequence after <pre> tag above, starting from ">".

Regards,
Edward

In reply to Click button not working in WWW::Mechanize by monkfan

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		`&`
	<		`<`
	>		`>`
	[		`[`
	]		`]`

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.