Dear all,

I have a sequence:

GAATGTTTTAGCAATCTCTTTCTGTCATGAATCCATGGCAGTGACCATACTAATGGTGACTGCCATTGAT
+GGAGGGAGACACA

[download]

and I want to be able to find this word in the sequence:

CTGGATAAGAATGTTTTAGCAATCTCTT

[download]
Problem is, the word is found at the beginning of the sequence, and in a truncated form (first 8 letters of word missing).

I was considering looping through successively smaller substrings of the word until it is found. I'd have to do it from either end of the word too, when trying to match an array of sequences.

My question is, is there a simpler way of using regexp to say find partial match?

I tried googling this but couldn't find the right combination of words (truncated/partial/overlap etc.) so any links to a solution would be greatly appreciated.

Many thanks
Sam

20061019 Janitored by Corion: Added code tags around sequences to enable wrapping

In reply to Searching for a word that may only exist in part by seaver

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.