i don't see any way to do it besides eating letters from the back, then starting over from the front.

here is one way, though index() would surely be faster than m// here. 

my $sequence = "GAATGTTTTAGCAATCTCTTTCTGTCATGAATCCATGGCAGTGACCATACTAAT
+GGTGACTGCCATTGATGGAGGGAGACACA";
my $find = "CTGGATAAGAATGTTTTAGCAATCTCTT";

my $found;

MATCH: {
    my $tail = $find;
    while ( length($tail) > 2 and not $found ) {
        ($found) = $sequence =~ /($tail)/  # find match
            or substr( $tail, 0, 1, '');   # or eat first letter

    }
    last MATCH if $found;

    my $head = $find;
    ## can chop first since exact match already failed
    while ( chop $head and length($head) > 2 and not $found ) {
        ($found) = $sequence =~ /($head)/;
    }
}

print "found? $found\n";

[download]
updated: to provide better(?) var names

In reply to Re: Searching for a word that may only exist in part by mreece
in thread Searching for a word that may only exist in part by seaver

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.