On one file (data.txt) I have a list like the following:
Contig25381
Contig25396
Contig25469
On another file (all.txt) I have a list of sequences like:
>R.fna.Contig25353
AAGCAGTGGTATCAACGCAGTAGTTGGTTCCATTACGGCCGGGCTCTGTT TCAGAATTTTAGATCCACCATCCGAGTTATTGAAACGCCAAGACCATAGA
>R.fna.Contig25381
GGACGAGATTTAACGACATCCATAAGCAACTCTGCTAATCATTCGATCTG CTTGGAGGTGTTTTTCCCCCATTTCCCTTAACCATGTCTCAGACTGTGGT
>R.fna.Contig25396
GGGATCTTTGGACGAAGGGGGGAAAAAGATGTCAACTTTAAGCATTCCAC CAATGCTTACTTCCCCTAGAGATGATGCCATTCAACTGTACAAGGCTTTC AAGGGATTTGGATGTGACACTTCTGCAGTAATCCATATCTTAGCTCGTCG
>R.fna.Contig25356
GGGAAGCAACCTGCCCTTCTCAGGCTTGCTCTAGATGATGTGCTTGAGGT GCCTTGATTAGTAGAGGTAGAAGAAGCAGAACAAAGGATTCACCTCGTTT
>R.fna.Contig25469
GGCTCTCTACCTATCTGTCTCTCTCTACCTCTCTCTCCTTTCACGCACAC
>R.fna.Contig25358
GGGAAGACGACGTCGTCACAACAAACCTCTCTTGAGGTTGGCAGCTTCCG
I would like to extract the sequences from the second file that would have the number listed in the first file. I tried to write all the lines in the first file into $line and then write sequences in the second file with elements seperated by ">". Then I tried to use grep and $line to get the matching elements from the second file. This approach only gives me the last match.
How can I get the full matched list? Each match on the list should have the line starting with '>' and then the full sequence until the line starting with the next '>'. Any tips would be appreciated. Thanks.

In reply to compare a list from one file with another text file by sm2004

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.