Hi, I have a problem formatting some output. I have a reference DNA sequence, that is a string of letters, for example:

atgtagctagctagctaacgagcgctagctagctagtgatgactgat

Then, I have several substrings that match against that reference sequence, and what I want is print the aligned sequences, for example:

ref     atgtagctagctagctaacgagcgctagctagctagtgatg
substr      agctagctagctaac
[download]

I have already stored the position where the substring starts matching, and the length of the substring, so, if it where just one substring, I could do something like this:

$reference_string = 'gctagctgatgctagcagcagcatgtagctagctgacga'
$substring = 'aatgctagctagc'

$output_line = qw{ } x length($reference_string);
substr $output_line, $start_position, $length, $substring;
print $reference_string, "\n", $output_line;
[download]

The problem is that I have many substrings, that sometimes overlap between eachother. The resulting output should look something like this:

ref    agctagctagctagcatgctagctagctgatcgatgctagctagctgactgacgacg
out1       atctagcat                    agctagcgatcga    gactgacagc
out2                             tagctagctgctagc
out3                       agtcgatcgatgctagc
[download]

So I thougth the following rules (something like pseudocode):

create one blank line of output
foreach substring
   take the first blank line
      if there is no overlap
         substr the blank line
      if there is overlap
         create a new blank line
         substr the new blank line
[download]

But then, I can find an overlap in that second blank line too, so I would have to repeat the process, checking if there is an overlap in the second blank line, etc. I thought of writing a recursive subroutine, checking each time if there is an overlap in the first blank line, and continuing deeper until it finds there is no overlap, or it creates a new one.

Do you think is it a good strategy? Can I make it in a more clear way? I found this way somewhat cumbersome, and I couldn't manage to solve it already. Thank you very much in advance for your help

Roger

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.