rogerd,
If there is no need to put more than one match on a line, the solution would look more like 
my $dna = 'gctagctgatgctagcagcagcatgtagctagctgacga';
for my $strand (@fragment) {
    my $pos = index($dna, $strand);
    next if $pos == -1;
    my $pad = ' ' x $pos;
    print $pad, $strand, "\n";
}

[download]
If you really need to put more than one match per line and don't care about efficiency (using the fewest number of total lines), you can use a bit mask to determine if "this" strand needs to go on to the next line. If you need help with that, speak up.

Cheers - L~R

In reply to Re: formatting output question (use of recursive subroutine?) by Limbic~Region
in thread formatting output question (use of recursive subroutine?) by rogerd

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.