Hi Monks, I have got a simple problem and want help from u guys. 1) I am reading a file fastaheaders.txt which contains something like +this >DFHGSUEIEEK >JKDHUEIEEOE >KDJIEEIOIEO 2) In the second file I am trying to search and print the lines when f +ound . It looks like this >DFHGSUEIEEK ACGTCGTACGATCGATCAGTACGTACGAT // >JKDHUEIEEOE ACGATGCGTACAGTACAGTACAGTACAGT // >KDJIEEIOIEO AGTCGTCGTAGTGTTTTACCCCCATGTCA // >HSKWJSSWWOW AGTAGTAGTAGTAGGGGTTTTTTTTACCC // >ADJHFHIOHFO ACGTGGGGGGGGGGTTATTACCCCCCCCA // >DTEEIJEJEOJE TTTTTTTTTTGGGGGGGGGACCCCCCCAT 3) I am trying to print only those fasta file which are in my fastahe +aders.txt file, i.e., >DFHGSUEIEEK >JKDHUEIEEOE >KDJIEEIOIEO. 4) Problem is that my program is doing that but like this:- >DFHGSUEIEEK >DFHGSUEIEEK >DFHGSUEIEEK >DFHGSUEIEEK ACGTCGTACGATCGATCAGTACGTACGAT ACGTCGTACGATCGATCAGTACGTACGAT ACGTCGTACGATCGATCAGTACGTACGAT ACGTCGTACGATCGATCAGTACGTACGAT // >JKDHUEIEEOE >JKDHUEIEEOE >JKDHUEIEEOE >JKDHUEIEEOE >JKDHUEIEEOE ACGATGCGTACAGTACAGTACAGTACAGT ACGATGCGTACAGTACAGTACAGTACAGT ACGATGCGTACAGTACAGTACAGTACAGT ACGATGCGTACAGTACAGTACAGTACAGT 6) Here is my program code... Can you please help me to whats going wr +ong ??? #!/usr/bin/perl open(FD, "<fastaheaders.txt"); @headers = <FD>; print "Enter the file name:"; $fn=<STDIN>; + open(FH,$fn) || die "Error opening the file:$fn"; while (<FH>) { foreach $head(@headers) { if (($head =~ /$_/) .. ($_ =~ /\/\//)) { print "$_"; } } } close FH; close FD; print "Loop Finished!";

In reply to While loop printing only one fasta header file by ashnator

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.