Hi Monks,

1) I am reading a file fastaheaders.txt which contains something like 
+this

>DFHGSUEIEEK
>JKDHUEIEEOE
>KDJIEEIOIEO

2) In the second file I am trying to search and print the lines when f
+ound . It looks like this

>DFHGSUEIEEK
ACGTCGTACGATCGATCAGTACGTACGAT
//
>JKDHUEIEEOE
ACGATGCGTACAGTACAGTACAGTACAGT
//
>KDJIEEIOIEO
AGTCGTCGTAGTGTTTTACCCCCATGTCA
//
>HSKWJSSWWOW
AGTAGTAGTAGTAGGGGTTTTTTTTACCC
//
>ADJHFHIOHFO
ACGTGGGGGGGGGGTTATTACCCCCCCCA
//
>DTEEIJEJEOJE
TTTTTTTTTTGGGGGGGGGACCCCCCCAT

3) I am trying to print only those fasta file which are in my  fastahe
+aders.txt file, i.e.,   
>DFHGSUEIEEK
>JKDHUEIEEOE
>KDJIEEIOIEO.



4) Problem is that my program is doing that but like this:-  
>DFHGSUEIEEK
>DFHGSUEIEEK
>DFHGSUEIEEK
>DFHGSUEIEEK
ACGTCGTACGATCGATCAGTACGTACGAT
ACGTCGTACGATCGATCAGTACGTACGAT
ACGTCGTACGATCGATCAGTACGTACGAT
ACGTCGTACGATCGATCAGTACGTACGAT
//
>JKDHUEIEEOE
>JKDHUEIEEOE
>JKDHUEIEEOE
>JKDHUEIEEOE
>JKDHUEIEEOE
ACGATGCGTACAGTACAGTACAGTACAGT
ACGATGCGTACAGTACAGTACAGTACAGT
ACGATGCGTACAGTACAGTACAGTACAGT
ACGATGCGTACAGTACAGTACAGTACAGT

6) Here is my program code... Can you please help me to whats going wr
+ong ???

#!/usr/bin/perl


open(FD, "<fastaheaders.txt");
@headers = <FD>;
print "Enter the file name:";

$fn=<STDIN>;                                                          
+                                                                    

open(FH,$fn) || die "Error opening the file:$fn";


 
 
while (<FH>)
 {
     foreach $head(@headers)
           {
               if (($head =~ /$_/) .. ($_ =~ /\/\//))
                        {
                               print "$_";
              
                        }
           }
 }

       
close FH;
close FD;
print "Loop Finished!";

[download]

In reply to One more problem by ashnator
in thread While loop printing only one fasta header file by ashnator

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.