If I have understood correctly, you could do a split using look-around assertions, see perlre, either using a look-ahead to split before your enzyme or a look-behind to split after it.

use strict;
use warnings;

open my $seqFH, q{<}, \ <<'EOD' or die qq{open: << HEREDOC: $!\n};
CAGTTTCGATCGAATC
ATTATTGGATCCGCAT
GCGTCAGGATCCAATC
EOD

my $sequence = join q{}, map { chomp; $_ } <$seqFH>;
close $seqFH or die qq{close: << HEREDOC: $!\n};

print qq{Sequence:\n     $sequence\n};

my $enzymeSeq     = q{GGATCC};
my $rxSplitBefore = qr{(?=$enzymeSeq)};
my $rxSplitAfter  = qr{(?<=$enzymeSeq)};

print qq{Splitting before $enzymeSeq\n};
my @chunksBefore  = split m{$rxSplitBefore}, $sequence;
print qq{     $_\n} for @chunksBefore;

print qq{Splitting after $enzymeSeq\n};
my @chunksAfter   = split m{$rxSplitAfter}, $sequence;
print qq{     $_\n} for @chunksAfter;

[download]

The output.

Sequence:
     CAGTTTCGATCGAATCATTATTGGATCCGCATGCGTCAGGATCCAATC
Splitting before GGATCC
     CAGTTTCGATCGAATCATTATT
     GGATCCGCATGCGTCA
     GGATCCAATC
Splitting after GGATCC
     CAGTTTCGATCGAATCATTATTGGATCC
     GCATGCGTCAGGATCC
     AATC

[download]

I hope I have guessed correctly and this is of some use.

Cheers,

JohnGG

Update: Corrected die text.

In reply to Re: splitting a string by johngg
in thread splitting a string by rkenshin09

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.