Dear monks, I am trying to write a simple script to align 2 sequence objects. The problem is that I get the following error message: Use of uninitialized value in concatenation (.) or string at C:/Perl/site/lib/Bio/Tools/Run/Alignment/Clustalw.pm line 645. Use of uninitialized value in concatenation (.) or string at C:/Perl/site/lib/Bio/Tools/Run/Alignment/Clustalw.pm line 646. 'align' is not recognized as an internal or external command, operable program or batch file. I would really appreciate some help. Here is my code. 
#c:\perl\perl.exe 
use strict; 
use warnings; 
use Bio::Seq;
use Bio::Tools::Run::Alignment::Clustalw; 

BEGIN { $ENV{CLUSTALDIR} = 'c:/CLUSTALW2/' } 

my $dna_seq = "NACCNANCGGGGGNNAAANTNNNACACTNCNGGGGGGNTNNTTANTGNGTNACAC
+ANNNGNCTNNNGGNNNCNANANTCNACAG +GACTTAGAAGNCTNCANNGGANCATNCCCTGCTANACN
+ANGNNANCACTCTNCAGNNCNNANCNTNGGGCNNCCTNNTCNNTNNNCCATNNGNGCTNC +ANNANCN
+TANANNGATNANTANAGNANNTTNTGTTATGNNGNGTG"; 

my$tn5_seq = "GGGGNCCCGCTTACGATACTTCGTTATAGCATACATTATACGAAGTTATCAGATCC
+CCCTGGATGGAAAACGGGAAAGGTTCCG +TCCAGGACGCTACTTGTGTATAAGAGTCAGGTT"; 

$dna_seq =~ s/\s+//g; 
$tn5_seq =~ s/\s+//g; 
my $id_1 = 'test1_DNA'; 
my $id_2 = 'test2_DNA'; 
my $alphabet = 'DNA';
 
my $seq_obj = Bio::Seq->new(-seq => $dna_seq, 
-display_id => $id_1, 
-alphabet => $alphabet); 

my $tn5_obj = Bio::Seq->new(-seq => $tn5_seq, 
-display_id => $id_2, 
-alphabet => $alphabet);
 
my @params = ('ktuple' => 2, 'matrix' => 'BLOSUM'); 

my $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params); 
my @seq_array =(); push @seq_array, $seq_obj, $tn5_obj;
my $seq_array_ref = \@seq_array; 
my $aln = $factory->align($seq_array_ref);

[download]

In reply to bioperl and clustalw help by julio_514

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.