Hello all;

I have a DNA sequence and I want to find all start codons(ATG,GTG,) and stop codons. I want to translate all possible subsequences betwen start and stop codons to their corresponding protein sequences.This should be on the 1st frame only.

For instance; $Dna = "AAAATGGGGTAAGTGAACGGGTAA" should return the corresponding proteins of "ATGGGGTAA" and "GTGAACGGGTAA" but should work also for very long sequences.

I have tried to write something like this but it doesnt seem to work:

#!/usr/bin/perl
use strict;
use strict;
use warnings;
use Bio::SearchIO;
use Bio::Seq;
use Bio::SeqIO;

my($seqio);
my($genio);

if(-e $ARGV[0]) {
       $seqio  = Bio::SeqIO->new( '-format' => 'fasta' , -file => $ARG
+V[0]);
} else {
       die "$ARGV[0] not found\n";
}


my($seq)        = "";
my($len)        = "";
my($head)        = "";


while ( my $seqobj = $seqio->next_seq ) {
       $len    = $seqobj->length();
       $head   = $seqobj->id();
       $seq    = $seqobj->seq();

    chomp($seq);
}


my(%genetic_code) = (
   
        'TCA' => 'S',    # Serine
        'TCC' => 'S',    # Serine
        'TCG' => 'S',    # Serine
        'TCT' => 'S',    # Serine
        'TTC' => 'F',    # Phenylalanine
        'TTT' => 'F',    # Phenylalanine
        'TTA' => 'L',    # Leucine
        'TTG' => 'L',    # Leucine
        'TAC' => 'Y',    # Tyrosine
        'TAT' => 'Y',    # Tyrosine
        'TAA' => '_',    # Stop
        'TAG' => '_',    # Stop
        'TGC' => 'C',    # Cysteine
        'TGT' => 'C',    # Cysteine
        'TGA' => '_',    # Stop
        'TGG' => 'W',    # Tryptophan
        'CTA' => 'L',    # Leucine
        'CTC' => 'L',    # Leucine
        'CTG' => 'L',    # Leucine
        'CTT' => 'L',    # Leucine
        'CCA' => 'P',    # Proline
        'CCC' => 'P',    # Proline
        'CCG' => 'P',    # Proline
        'CCT' => 'P',    # Proline
        'CAC' => 'H',    # Histidine
        'CAT' => 'H',    # Histidine
        'CAA' => 'Q',    # Glutamine
        'CAG' => 'Q',    # Glutamine
        'CGA' => 'R',    # Arginine
        'CGC' => 'R',    # Arginine
        'CGG' => 'R',    # Arginine
        'CGT' => 'R',    # Arginine
        'ATA' => 'I',    # Isoleucine
        'ATC' => 'I',    # Isoleucine
        'ATT' => 'I',    # Isoleucine
        'ATG' => 'M',    # Methionine
        'ACA' => 'T',    # Threonine
        'ACC' => 'T',    # Threonine
        'ACG' => 'T',    # Threonine
        'ACT' => 'T',    # Threonine
        'AAC' => 'N',    # Asparagine
        'AAT' => 'N',    # Asparagine
        'AAA' => 'K',    # Lysine
        'AAG' => 'K',    # Lysine
        'AGC' => 'S',    # Serine
        'AGT' => 'S',    # Serine
        'AGA' => 'R',    # Arginine
        'AGG' => 'R',    # Arginine
        'GTA' => 'V',    # Valine
        'GTC' => 'V',    # Valine
        'GTG' => 'V',    # Valine
        'GTT' => 'V',    # Valine
        'GCA' => 'A',    # Alanine
        'GCC' => 'A',    # Alanine
        'GCG' => 'A',    # Alanine
        'GCT' => 'A',    # Alanine
        'GAC' => 'D',    # Aspartic Acid
        'GAT' => 'D',    # Aspartic Acid
        'GAA' => 'E',    # Glutamic Acid
        'GAG' => 'E',    # Glutamic Acid
        'GGA' => 'G',    # Glycine
        'GGC' => 'G',    # Glycine
        'GGG' => 'G',    # Glycine
        'GGT' => 'G',    # Glycine
    );
    
 my @startsRF1 =();
    my @startsRF2 =();
    my @startsRF3 =();
    my @stopsRF1 = ();
    my @stopsRF2 = ();
    my @stopsRF3 = ();
    my @arrayOfORFs = ();
    my @arrayOfTranslations = ();
    
    my $joinedAminoAcids = ();

    while ($seq =~ m/ATG|TTG|CTG|ATT|CTA|GTG|ATT/gi){
    my $matchPosition = pos($seq) - 3;
    if (($matchPosition % 3) == 0) {
        push (@startsRF1, $matchPosition);
        }
        
        
        while ($seq =~ m/TAG|TAA|TGA/gi){
    my $matchPosition = pos($seq);
    if (($matchPosition % 3) == 0) {
        push (@stopsRF1, $matchPosition);
      }  
        
     my $codonRange = "";
         my $startPosition = 0;
        my $stopPosition = 0;

        @startsRF1 = reverse(@startsRF1);
        @stopsRF1 = reverse(@stopsRF1);
    while (scalar(@startsRF1) > 0) {
    $codonRange = "";
    $startPosition = pop(@startsRF1);
    if ($startPosition < $stopPosition) {
        next;
    }
    
    
    my $ORFseq = "";
    
    while (scalar(@stopsRF1) > 0) {
        $stopPosition = pop(@stopsRF1);
        if ($stopPosition > $startPosition) {

        my $difF = $stopPosition - $startPosition;
        $ORFseq = substr($seq, $startPosition,(length($seq)-$difF));
        push (@arrayOfORFs, $ORFseq);
        
        
        }
    foreach $ORFseq (@arrayOfORFs){
        
    my @growingProtein = ();
    for (my $i = 0; $i <= (length($ORFseq) - 3); $i = $i + 3) {
    my $codon = substr($ORFseq, $i, 3);
    if (exists( $genetic_code{$codon} )){
        push (@growingProtein, $genetic_code{$codon});
           }
    else {
        push (@growingProtein, "X");
    }
    }
    my $joinedAminoAcids = join("",@growingProtein);
    push (@arrayOfTranslations, $joinedAminoAcids);
}

foreach(@arrayOfTranslations) {
   print $_, "\n";
   
    }
      }

   }

  }


}
[download]

I NEED HELP URGENTLY PLEASE.

Regards,
Emman

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.