Hello all;
I guess my earlier post was not very readable.

I have a DNA sequence and I want to find all start codons(ATG,GTG,) and stop codons. I want to translate all possible subsequences betwen start and stop codons to their corresponding protein sequences.This should be on the 1st frame only. For instance; $Dna = "AAAATGGGGTAAGTGAACGGGTAA" should return the corresponding proteins of "ATGGGGTAA" and "GTGAACGGGTAA" but should work also for very long sequences

. I tried to do something like this in the middle of my code: 
while ($seq =~ m/ATG|TTG|CTG|ATT|CTA|GTG|ATT/gi){ 
  my $matchPosition = pos($seq) - 3; 
  if (($matchPosition % 3) == 0) { 
    push (@startsRF1, $matchPosition); 
  } 
  while ($seq =~ m/TAG|TAA|TGA/gi){ 
    my $matchPosition = pos($seq); 
    if (($matchPosition % 3) == 0) { 
     push (@stopsRF1, $matchPosition); 
    }

[download]

But basically; I need to put all possible seubsequences between stats and stops, as above, in an array and then translate each of them

I need help with this.
Emman

In reply to Orf subsequences by odegbon

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.