If you bitwise or (|) an uppercase letter with a space, (assuming latin-1/ASCII files), it will lowercase it:

print 'ACGT' | ' ';; acgt

So, if you translate all the 'N's in your mask to spaces and then bitwise or the sequence and the mask, it will achieve your goal very efficiently:

$s = 'GGTACACAGAAGCCAAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGACCGAT';; $m = 'GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT';; ( $mm = $m ) =~ tr[N][\x20];; print $mm;; GGT T print $s | $mm;; GGTacacagaagccaaagcaggctccaggctctgagctgtcagcacagagaccgaT

Which makes your entire program (excluding the unmentioned fact that your files may be in FASTA format):

#! perl -slw use strict; open SEQ, '<', 'data1.dat' or die $!; open MASK, '<', 'data2.dat' or die $!; while( my $seq = <SEQ> ) { ## Read a sequence my $mask = <MASK>; ## And the corresponding mask $mask =~ tr[N][ ]; ## Ns => spaces print $seq | $mask; ## bitwise-OR them and print the result } close SEQ; close MASK;

Redirect the output to a third file and you're done.


Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.
"Too many [] have been sedated by an oppressive environment of political correctness and risk aversion."

In reply to Re: Lower-casing Substrings and Iterating Two Files together by BrowserUk
in thread Lower-casing Substrings and Iterating Two Files together by neversaint

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.