Dear monks, I am using php for making an webserver. since i know a little of perl compared to PHP, the values which is on the php page is passed to a perl program. To make things easier, i am using unix system command. For example, to search an input ID, i use unix grep command. Since, i also need the sequence of the given ID, my program looks like this. 
file name1:seq.txt
-------------------
>ID_101
AGCTGAGTAGACTGA
>ID_102
CGATGCTAGCTAGCTACAT
>ID_103
ATCTTATCTTTTTATACC

file name2:seq_updated.txt
--------------------------
>ID_104
AATAGCTAGAAGGA
>ID_105
AGATCGACTGAA
>ID_106
ACTAGCTACGATATATTATATATAT

my php page:
-----------
$foo="ID_106" //ID to be searched.
$cmd="perl split.pl $foo";
echo exec($cmd);

my perl program:
---------------
$bar=$ARGV[0];
print exec("grep -h -A 1 $bar *.txt");

[download]
My doubts: Why am i not able to store the exec command in a scalar or array variable and then print it. It doesnt work that way, and it works only if i print it directly. I need to save it to a variable because, i need to split the sequence line into 5 characters per line. 
what i was planning to do with the variable is this:
----------------------------------------------------
foreach $str(@array){
    if($str=~/\w+/){@strs=split(//,$str);
    for($i=1;$i<=scalar(@strs);$i++){
        print "$strs[$i] ";
        if($i%5==0){print"\n";}            
    }
  }
}
}

this is how my webpage result should look like:
-----------------------------------------------
>ID_106
ACTAG
CTACG
ATATA
TTATA
TATAT

[download]
well, am i making things complicated? Can i use unix one liner system command to print 5 characters per line when i grep the ID? Please guide. Thank you.

In reply to system command and formatting by sugar

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.