You're not understanding correctly, and that's probably my fault. If I retrieve the entire contents and change it there, I've messed the tags that I put in the string to mark where I want to highlight. Here's a better set of sample code. I'm demonstrating my first idea if you set $idea=0. If you go into highlightText2 and uncomment where I've said to break, you can see why I'm not using the original idea, but it does appear better here then when I originally wrote the test code on slightly different text. 
use Tk;

  $idea = 0;
  
  $rawSequence="atggcgacgaaggccgtgtgcgtgctgaagggcgacggcccagtgcagggcatc
+atcaatttcgagcagaaggaaagtaatggaccagtgaaggtgtggggaagcattaaaggactgactgaa
+ggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcac
+tttaatcctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggcaat
+gtgactgctgacaaagatggtgtggccgatgtgtctattgaagattctgtgatctcactctcaggagac
+cattgcatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaa
+gaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaataaaca
+ttcccttggatgtagtctgaggcccct";
  my $mainWindow = MainWindow->new();

  if( $idea)
  {
    # Main Window
    $mainWindow->title("Regex Problem Example 1");    
    $mainWindow->minsize(qw(500 500));  #Sets Minimum Size - note lack
+ of comma
    $mainWindow->geometry('+500+200');  #Sets Position - note lack of 
+comma
    $mainWindow->optionAdd('*font'=>'Courier 10');
  
    $ROText = $mainWindow->Scrolled('ROText',
                                -scrollbars=>'osoe');
  
    $formattedSequence = formatSequence($rawSequence);
    $ROText->Insert($formattedSequence);
    $ROText->pack;
    
    highlightText($ROText, "gca");
  }
  else
  {
    # Main Window
    $mainWindow->title("Regex Problem Example 2");    #Sets Title
    $mainWindow->minsize(qw(500 500));  #Sets Minimum Size - note lack
+ of comma
    $mainWindow->geometry('+500+200');  #Sets Position - note lack of 
+comma
    $mainWindow->optionAdd('*font'=>'Courier 10');
  
    $ROText = $mainWindow->Scrolled('ROText',
                                -scrollbars=>'osoe');
  
    $formattedSequence = searchAndFormatSequence($rawSequence);
    $ROText->Insert($formattedSequence);
    $ROText->pack;
    
    #This works, but I can't make Uppercase->Lowercase
    #without removing the tags.
    highlightText2($ROText, "[A-Z]+");
    
  }
MainLoop();


sub highlightText {
    my ($widget, $searchString) = @_;
 
    #alter search string - HOW?    
    
    # Create a tag to configure the text
    $widget->tagConfigure('foundtag',
                            -foreground => "white",
                            -background => "red");
    $widget->FindAll(-regex, -nocase, $searchString);
    if ($widget->tagRanges('sel'))
    {
        my %startfinish  = $widget->tagRanges('sel');
        foreach(sort keys %startfinish)
        {
            $widget->tagAdd("foundtag", $_, $startfinish{$_});
        }
        $widget->tagRemove('sel', '1.0', 'end');
    }
}

sub highlightText2 {
    my ($widget, $searchString) = @_;
 
    #alter search string - HOW?    
    
    # Create a tag to configure the text
    $widget->tagConfigure('foundtag',
                            -foreground => "white",
                            -background => "red");
    $widget->FindAll(-regex, -case, $searchString);
    if ($widget->tagRanges('sel'))
    {
        my %startfinish  = $widget->tagRanges('sel');
        foreach(sort keys %startfinish)
        {
            $widget->tagAdd("foundtag", $_, $startfinish{$_});
        }
        $widget->tagRemove('sel', '1.0', 'end');
    }
    #UNCOMMENT TO BREAK! Doesn't like a regex in the replace string
    #$widget->FindAndReplaceAll(-regex, -case, "G", "g");
    #$widget->FindAndReplaceAll(-regex, -case, "C", "c");
    #$widget->FindAndReplaceAll(-regex, -case, "A", "a");

}


sub searchAndFormatSequence
{
    #I search the sequence and change any gca in the sequence to GCA t
+hen
    #format the sequence, the end result of which is

    return "        1 atggcgacga aggccgtgtg cgtgctgaag ggcgacggcc cagt
+GCAggG CAtcatcaat
       61 ttcgaGCAga aggaaagtaa tggaccagtg aaggtgtggg gaaGCAttaa aggac
+tgact
      121 gaaggcctGC Atggattcca tgttcatgag tttggagata atacaGCAgg ctgta
+ccagt
      181 GCAggtcctc actttaatcc tctatccaga aaacacggtg ggccaaagga tgaag
+agagG
      241 CAtgttggag acttggGCAa tgtgactgct gacaaagatg gtgtggccga tgtgt
+ctatt
      301 gaagattctg tgatctcact ctcaggagac cattGCAtca ttggccGCAc actgg
+tggtc
      361 catgaaaaaG CAgatgactt ggGCAaaggt ggaaatgaag aaagtacaaa gacag
+gaaac
      421 gctggaagtc gtttggcttg tggtgtaatt gggatcgccc aataaacatt ccctt
+ggatg
      481 tagtctgagg cccct";
    
}


sub formatSequence
{
    #I do some really neat formatting here the end result of which is.
+..
    
    return "        1 atggcgacga aggccgtgtg cgtgctgaag ggcgacggcc cagt
+gcaggg catcatcaat
       61 ttcgagcaga aggaaagtaa tggaccagtg aaggtgtggg gaagcattaa aggac
+tgact
      121 gaaggcctgc atggattcca tgttcatgag tttggagata atacagcagg ctgta
+ccagt
      181 gcaggtcctc actttaatcc tctatccaga aaacacggtg ggccaaagga tgaag
+agagg
      241 catgttggag acttgggcaa tgtgactgct gacaaagatg gtgtggccga tgtgt
+ctatt
      301 gaagattctg tgatctcact ctcaggagac cattgcatca ttggccgcac actgg
+tggtc
      361 catgaaaaag cagatgactt gggcaaaggt ggaaatgaag aaagtacaaa gacag
+gaaac
      421 gctggaagtc gtttggcttg tggtgtaatt gggatcgccc aataaacatt ccctt
+ggatg
      481 tagtctgagg cccct";

}

[download]

In reply to Re^2: Searching Formatting and Highlighting Text Problem by janusmccarthy
in thread Searching Formatting and Highlighting Text Problem by janusmccarthy

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.