Actually I was interested in what kinds of trouble you ran into, but anyway...

There's a trick in Perl that makes that quite easy: you can set the input record separator to '>', so that the <DATA> iterator gives you chunks splitted by '>': 

use strict;
use warnings;

local $/ = '>';

my $c = 0;
while (<DATA>) {
    chomp;
    next unless length;
    my $fn = "file" . ++$c;
    open my $handle, '>', $fn or die "Can't open `$fn' for writing: $!
+";
    print $handle '>', $_;
    close $handle or warn $!;
}

__DATA__
>i:/13414 Ccl9 (88)/sequencing/13414_fasta.Contig1
TTTCTCCGGCCCCCTCCTCCCGCGGGGGAAAAAACCCGGGGAGCAGTCGG
GCAGGGGTTTTTTGGTTTTTTCAAAATAAAAAGGGGTGCCCGTTGGGGGGcd 
GGGGGGGTGCAGGTTTCAACCCCCCCCCCCAAAGAAAAAAAAATTTTGGG
GAATTTTTGGGGGGCTCCACCAGTTTTCGGGGTTTTTGGGCCTTTTCAGA
AGGTAGGTTGGACGCGGATTGGGCAATAAACCACCCCGCTTCATCGGATA
ATTTTCCCCGGCCGAAAAGGGCCGCGGGGCCGGTGGGCGGCCTTGGGTTT
>i:/13414 Ccl9 (88)/sequencing/13414_fasta.Contig2
TAAACCCAAGGCCCCCCAGGTAAAAAAAAAACCGGCCAGGGGGGGGGGGG
TAAAAAAAACCAAGTGTCACCCAGGGTGGAGATCCCCGGAAAAGGAAAAG
GGGGGTTTTTTATTCGAAACGGGGAAAACTTTCACAAAATTTTGGAAGAA
TCCCCTTTAATGTTTTCTTTTCAAAAGGGGGTAAAAAAACCACCTTTAAA
AAGAAGTCTACCTTGGGAAAAAATAATTTTTGGGAAAATTTAAAAATTGA

[download]

In reply to Re^3: splitting fasta file into individual fasta files by moritz
in thread splitting fasta file into individual fasta files by lomSpace

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.