No, A gene is like this: it is preceded by a string TATAAT and after this string there can be one or many strings of letters A,C,G,T . then ATG string follows them, then again random amount of A,C,G,T's follow it and the gene ends with one of the strings TAA, TGA or TAG. for example a line is TATAATATTACAATGGATCATACAGTTAG ... our gene is the part between ATG and TAG (ATGGATCATACAGTTAG here) but we also have to make sure it is preceded by a TATAAT.. I have to print out the genes in the txt file according to these rules.