I agree with the above, there are plenty of modules to help with parsing FASTA, the best documanted and supported are on BioPerl though:
http://www.bioperl.org/wiki/FASTA_sequence_format

Or you can set the line delimiter to the FASTA record separator (>) :
$/ = '>';
and slurp in the FASTA one record at a time.

As far as reverse complmenting goes, i am sure there is support out there, but it is very simple to do yourself:

my $seq = 'AGCTGATCGTAATAGAGCTA';
my $rev = rev_comp($seq,);
print "The reverse complement of \'$seq\' is \'$rev\'\n";
sub rev_comp{
  my $in = shift;
  ## reverse it
  my $rev_comp = reverse($in);
  ## complment it using tr///
  my $count = $rev_comp =~ tr/AGCT/TCGA/i; ## or tr/AGCTN/TCGAN/i if y
+ou have N's
  ## check we changed all the bases, or did something weird occur...
  if ($count = length($rev_comp){

    return $rev_comp;
  } else {

    ## not all bases were changed, 
    ## so something weird is happenning
    ## maybe you still have whitespace, or N's etc...

    return an error;
  }

}

[download]

Obviously this is a lengthy way of doing it but i am trying to keep things clear! Hope it helps.

Just a something something...

In reply to Re^2: Extracting DNA sequences from FASTA files by BioLion
in thread Extracting DNA sequences from FASTA files by statsman5

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.