I guess u re talking about the Needleman Wunsch algorithm. I can help you in working out some steps but I think u need to define the gap penalty, match and mismatch score prior to get the alignment.

1. Build an empty matrix where you can calculate the score and also have a pointer for the tracing back so that you can calculate the matches and subsequently get the gaps/mismatches.

2. Filling the matrix and then tracing back the matrix 

my @matrix;
$matrix[0][0]{score}   = 0;
$matrix[0][0]{pointer} = "none";
for(my $j = 1; $j <= length($seq1); $j++) {
    $matrix[0][$j]{score}   = $GAP * $j;
    $matrix[0][$j]{pointer} = "left";
}
for (my $i = 1; $i <= length($seq2); $i++) {
    $matrix[$i][0]{score}   = $GAP * $i;
    $matrix[$i][0]{pointer} = "up";
}

# fill
for(my $i = 1; $i <= length($seq2); $i++) {
    for(my $j = 1; $j <= length($seq1); $j++) {
        my ($diagonal_score, $left_score, $up_score);

        # calculate match score
        my $letter1 = substr($seq1, $j-1, 1);
        my $letter2 = substr($seq2, $i-1, 1);                         
+   
        if ($letter1 eq $letter2) {
            $diagonal_score = $matrix[$i-1][$j-1]{score} + $MATCH;
        }
        else {
            $diagonal_score = $matrix[$i-1][$j-1]{score} + $MISMATCH;
        }

        # calculate gap scores
        $up_score   = $matrix[$i-1][$j]{score} + $GAP;
        $left_score = $matrix[$i][$j-1]{score} + $GAP;

        # choose best score
        if ($diagonal_score >= $up_score) {
            if ($diagonal_score >= $left_score) {
                $matrix[$i][$j]{score}   = $diagonal_score;
                $matrix[$i][$j]{pointer} = "diagonal";
            }
        else {
                $matrix[$i][$j]{score}   = $left_score;
                $matrix[$i][$j]{pointer} = "left";
            }
        } else {
            if ($up_score >= $left_score) {
                $matrix[$i][$j]{score}   = $up_score;
                $matrix[$i][$j]{pointer} = "up";
            }
            else {
                $matrix[$i][$j]{score}   = $left_score;
                $matrix[$i][$j]{pointer} = "left";
            }
        }
    }
}
# trace-back

my $align1 = "";
my $align2 = "";

# start at last cell of matrix
my $j = length($seq1);
my $i = length($seq2);

while (1) {
    last if $matrix[$i][$j]{pointer} eq "none"; # ends at first cell o
+f matrix

    if ($matrix[$i][$j]{pointer} eq "diagonal") {
        $align1 .= substr($seq1, $j-1, 1);
        $align2 .= substr($seq2, $i-1, 1);
        $i--;
        $j--;
    }
    elsif ($matrix[$i][$j]{pointer} eq "left") {
        $align1 .= substr($seq1, $j-1, 1);
        $align2 .= "-";
        $j--;
    }
    elsif ($matrix[$i][$j]{pointer} eq "up") {
        $align1 .= "-";
        $align2 .= substr($seq2, $i-1, 1);
        $i--;
    }    
}
$align1 = reverse $align1;
$align2 = reverse $align2;
print "$align1\n";
print "$align2\n";

[download]

For match = 1, mismatch = -1 and gap = -1.

Input 

ATGTAGACCTAGATCATGATGACTGATGAT
ATTACCGATGACTGATGACTGATGACTGAT

[download]

Output 

ATGTAGACCTA-GA-TCATGA-TGACTGA-TGAT
AT-T--ACCGATGACTGATGACTGA-TGACTGAT

[download]

In reply to Re: Sequence alignment by snape
in thread Sequence alignment by nicholaspr

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.