Thank you very many, almut ;-). Now I have an efficient way to extract sequences from a fasta file (doing bioinformatics stuff). It is more than 10times faster than the awk oneliner from my first post.
Here is almuts code slighly adjusted. It can be used to extract sequences from a multifasta file. 


usage extract-seq.pl file1 file2
cat file1
AV12349
J234054
   .
   .
cat file2
>AV12349
AAACCGTACCTAGAACAGTA
ACAGTACA
>J434594
ACCGTTAGTACGATACA
    .
    .

[download]

file1 contains ID to extract, file2 contains sequences in multifasta format. output will be written
to the file extracted.seqs 


#!/usr/bin/perl

$output = "extracted.seqs";

open (OUT,">$output") or die;

# create names lookup table from first file
while (<>) {
    chomp;
    $names{$_} = 1;
    last if eof;
}
$/ = "\n>";  # set input record separator

# scan second file
while (<>) {
     s/^>//;  #remove leading ">"
     s/>$//;  #remove trailing ">"

     if (/^([\w\d]+)/ && $names{$1}) { print OUT ">$_";}

}

[download]

In reply to Re^4: awk 2 perl oneliner by space_agent
in thread awk 2 perl oneliner by space_agent

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.