Here are the actual sequnces I analyse: for GENES: 
>uc002yje.1 chr21:13973492-13976330 
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaacccggccccgcagagccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
>uc002yje.1 chr21:13973492-13976330 
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
>uc002yje.1 chr21:13973492-13976330 
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG

for motifs:
>ucmotif_1
gccccac
>ucmotif_2
gggggaaaaaacc
>ucmotif_3
agagggccc


here is the output:
 the distance is the following: 88
 the distance is the following: 20
 the distance is the following: 4

[download]
So, now the program searches for the first element in the first gene and for the second in the second and so on. I wish that it could find any of motifs for each gene if they present in it and count the length between the motif an exon start point (starts with capital letters).

In reply to Re^3: How to find any of many motifs? by Nikulina
in thread How to find any of many motifs? by Nikulina

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.