You and your friend came close. Most of your problems, including the uninit issues, were the result of 'off-by-one' errors in array assignment, etc.

That said, this is also close (only "close" because the output formatting is NOT per your spec; correction is left as an exercise...) and utilizes what I believe to be some relatively minor corrections to your code.

#!/usr/bin/perl
use strict;
use warnings;

# 847021

=head OUTPUT OF THIS VERS:

>Long_DNA_Scaffold.0
atgctagsctgtagctagctagtcgatgctagtagct
ttagctagctgatgctagtcgatgctagtcatctagc

>Long_DNA_Scaffold.1

tagctagctagctgatcgtagctagtcgtagctagct
ggtcgatgctgatcgtagctgatgctagtcgatgcta
>                                       # removal of ">" and blank lin
+es left as an exercise....
>Long_DNA_Scaffold2.0
atgctagsctgtagctagctagtcgatgctagtagct
tagctagctgatcgtagctagctgatgctagctagtc

>Long_DNA_Scaffold2.1

tagctagctagctgatgctagctagtcgatcgtagct
ggctagtgctagtgctagctgatgctagtcgtagctg

=cut

my $file = "847021.txt";
open (IN, '<', $file) or die "Can't open $file: $!";    # test your fi
+le opens!

$/=">";
my $i=0;
my $separator_count=0;
my (@seq, $seq, @name, $name);

while (<IN>) {
    if(/^(\S+)?.*?\n(.*)/ms) {
        # $i++;                                         # this creates
+ an empty ("undef") element 0 in the arrays; mis-located; moved
        $seq[$i]=$2; 
        $name[$i]=$1; 
    } else {
        $separator_count++;
        if ($separator_count > 1) {
            print "No match for current data: $_\n\n";      # one inst
+ance is expected because the data begins with record separator; don't
+ show it
        } else {
            next;                                        # create no u
+ndef $arr[0]
        }
      }
$i++;                                                    # re-located 
+from line 57
}
close IN;
print "\n";

for my $j(0..$#seq) {                                    #   $#seq: in
+dex of last element. 0..$i replacing OP's 1..$i

    $name[$j] =~ tr/>//;                                 # replaces OP
+'s mis-coded tr//; see toolic's reply, above re tr syntax
    $seq[$j] =~ tr/>//;
    my @sequence=split(/N+/,$seq[$j]);

    my $n=length(@sequence);
    my$seqs_to_print=$n;                                 # OP's decrem
+ent caused failure to print second elements of @seq
    for my $k(0..$seqs_to_print){                        # use $i, $j,
+ $k for counters; $x and company are typically for substantive data  
    print ">$name[$j].$k\n";
    print "$sequence[$k]\n";
    }
    $j++;
}

[download]

Those comments above re good practice should be read as ADDITIONS to toolic's list.

In reply to Re: Seeking help with script by ww
in thread Seeking help with script by docalf

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.