Hello all,

I have multiple XML files in a directory. They have the following information: 

<?xml version="1.0"?>
<t_volume>
        <info>
            <info_name>FZGA34177.b1</info_name>
            <center_project>4085729</center_project>
            <base_file>SETARIA_ITALICA/JGI/fasta/FZGA34177.b1.fasta</b
+ase_file>
            <qual_file>SETARIA_ITALICA/JGI/qscore/FZGA34177.b1.qscore<
+/qual_file>
            <it_flank_left>AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGG
+ATCCCAC</it_flank_left>
            <it_flank_right>GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAG
+TATTCTAT</it_flank_right>
            <it_size>35000</it_size>
            <it_stdev>3500</it_stdev>
            <plate_id>357</plate_id>
            <program_id>KB 1.3.0</program_id>
            <seq_lib_id>FZGA</seq_lib_id>
            <ncbi_project_id>32913</ncbi_project_id>
            <ncbi_info_archive>
                <ti>2167749207</ti>
                <taxid>4555</taxid>
                <basecall_length>899</basecall_length>
                <load_date>Nov 26 2008  4:06PM</load_date>
                <state>active</state>
            </ncbi_info_archive>
        </info>
        <info>
            <info_name>FZGA34178.b1</info_name>
            <center_project>4085729</center_project>
            <base_file>SETARIA_ITALICA/JGI/fasta/FZGA34177.b1.fasta</b
+ase_file>
            <qual_file>SETARIA_ITALICA/JGI/qscore/FZGA34177.b1.qscore<
+/qual_file>
            <it_flank_left>AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGG
+ATCCCAC</it_flank_left>
            <it_flank_right>GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAG
+TATTCTAT</it_flank_right>
            <it_size>12000</it_size>
            <it_stdev>1200</it_stdev>
            <plate_id>357</plate_id>
            <program_id>KB 1.3.0</program_id>
            <seq_lib_id>FZGA</seq_lib_id>
            <ncbi_project_id>32913</ncbi_project_id>
            <ncbi_info_archive>
                <ti>2167749207</ti>
                <taxid>4555</taxid>
                <basecall_length>899</basecall_length>
                <load_date>Nov 26 2008  4:06PM</load_date>
                <state>active</state>
            </ncbi_info_archive>
        </info>
        <info>
            <info_name>FZGA34179.b1</info_name>
            <center_project>4085729</center_project>
            <base_file>SETARIA_ITALICA/JGI/fasta/FZGA34177.b1.fasta</b
+ase_file>
            <qual_file>SETARIA_ITALICA/JGI/qscore/FZGA34177.b1.qscore<
+/qual_file>
            <it_flank_left>AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGG
+ATCCCAC</it_flank_left>
            <it_flank_right>GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAG
+TATTCTAT</it_flank_right>
            <it_size>7000</it_size>
            <it_stdev>700</it_stdev>
            <plate_id>357</plate_id>
            <program_id>KB 1.3.0</program_id>
            <seq_lib_id>FZGA</seq_lib_id>
            <ncbi_project_id>32913</ncbi_project_id>
            <ncbi_info_archive>
                <ti>2167749207</ti>
                <taxid>4555</taxid>
                <basecall_length>899</basecall_length>
                <load_date>Nov 26 2008  4:06PM</load_date>
                <state>active</state>
            </ncbi_info_archive>

        </info>
        <info>
            <info_name>FZGA34180.b1</info_name>
            <center_project>4085729</center_project>
            <base_file>SETARIA_ITALICA/JGI/fasta/FZGA34177.b1.fasta</b
+ase_file>
            <qual_file>SETARIA_ITALICA/JGI/qscore/FZGA34177.b1.qscore<
+/qual_file>
            <it_flank_left>AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGG
+ATCCCAC</it_flank_left>
            <it_flank_right>GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAG
+TATTCTAT</it_flank_right>
            <it_size>3000</it_size>
            <it_stdev>300</it_stdev>
            <plate_id>357</plate_id>
            <program_id>KB 1.3.0</program_id>
            <seq_lib_id>FZGA</seq_lib_id>
            <ncbi_project_id>32913</ncbi_project_id>
            <ncbi_info_archive>
                <ti>2167749207</ti>
                <taxid>4555</taxid>
                <basecall_length>899</basecall_length>
                <load_date>Nov 26 2008  4:06PM</load_date>
                <state>active</state>
            </ncbi_info_archive>

        </info>
        <info>
            <info_name>FZGA34181.b1</info_name>
            <center_project>4085729</center_project>
            <base_file>SETARIA_ITALICA/JGI/fasta/FZGA34177.b1.fasta</b
+ase_file>
            <qual_file>SETARIA_ITALICA/JGI/qscore/FZGA34177.b1.qscore<
+/qual_file>
            <it_flank_left>AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGG
+ATCCCAC</it_flank_left>
            <it_flank_right>GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAG
+TATTCTAT</it_flank_right>
            <it_size>7000</it_size>
            <it_stdev>700</it_stdev>
            <plate_id>357</plate_id>
            <program_id>KB 1.3.0</program_id>
            <seq_lib_id>FZGA</seq_lib_id>
            <ncbi_project_id>32913</ncbi_project_id>
            <ncbi_info_archive>
                <ti>2167749207</ti>
                <taxid>4555</taxid>
                <basecall_length>899</basecall_length>
                <load_date>Nov 26 2008  4:06PM</load_date>
                <state>active</state>
            </ncbi_info_archive>
        </info>

[download]

I want to retrieve some information from these files as a hash (key and value).

I am trying to parse this XML file as :

#!/usr/bin/perl

use XML::Simple;
use Data::Dumper;

$xml = new XML::Simple(KeyAttr=>[]);
$data = $xml -> XMLin("InfoFile.xml");
#print Dumper($info);

print "XML read in\n";

foreach $e (@{$data->{info}})
{    
    print $e->{info_name},"\n";
    print "it Size: ", $e->{it_size}, "\n";
    print "\n";
}

[download]

My code is reading the XML file, but is not printing in foreach loop. Can someone please suggest me as where I am going wrong?

Furthermore, I have multiple fasta files and I want to compare the XML key information (i.e. <info_name>...</info_name>) with the Fasta header name. The example of a fasta file is: 

>FZGA34177.b1 bg_2167749207  
CATAACAGGAGAGTAAACATGTAACTCCTATAACTCGCGGGGTGTGCTGTTATTACCTCCTTGGTGGAAC
AGGAAACCTGGGAAACGCTTGTTCAGATATTCGTCTGTTTCCCATGTTGCTTCATCTTCAGTGTGGTTTA
>FZGA34178.b1 bg_2167749208  
ACTCTCTTGAGGCATTCACCGGATTGACCGGCGGTGTCCTGGAAGGAGGTGTCCTTCAGGCCTCGTTCAG
TAGCATAGGATTGGCACTAGACCAAATTTTGATCATGGTCAGGATCGAGTGGATCCTGTTTTCTCATTGA
AACTTGGTGACTAATCATTCCTCCCCAGGATCAAAACCATTGATTCAAAAGCAGTGTTTGGCTGGAGAGG
AAAGAAAACAGGGGATCAAATAGAGCTGTACTAGAAAGCAATGAACAGAGCTGGCTAGGATCCAGAGCCA
>FZGA34179.b1 bg_2167749209  
CAGCCTTGGCCGACAGGCCCGGGTAATCTTGGGAAATTTCATCGTGATGGGGATAGATCATTGCAATTGT
TGGTCTTCAACGAGGAATGCCTAGTAAGCGCGAGTCATCAGCTCGCGTTGACTACGTCCCTGCCCTTTGT
ACACACCGCCCGTCGCTCCTACCGATTGAATGGTCCGGTGAAGTGTTCGGATCGCGGCGACGGAGGCGGT

[download]

If the header element of fasta (eg: FZGA34177.b1) matches <info_name> (eg: <info_name>FZGA34177.b1</info_name>), it will check the hash value (eg: <it_size>35000</it_size>) and write the fasta sequence (header and sequence both), to a new file (eg: 35000.fasta.output). Similarly, there will be various other files corresponding to "it_size". The issue is these XML files and fasta files are multiple files, and I thus need to read all of them all together in order to find the sequence corresponding to <it_size>.

Can someone please guide me as to how to go about this problem??

Thanks.

In reply to Parse XML and compare with Fasta in Perl by ad23

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.