Maybe this is what you are looking for.

use warnings; use strict; open( F1, "subsettest.txt" ) or die "file1: $!"; open( F2, "subsettest1.txt" ) or die "file2: $!"; while ( my $s1 = <F1> ) { my $s2 = <F2>; if ( $s1 =~ /^>/ ) { print $s1; } else { print $s2,$s1; } } close F1; close F2; exit;
>GK9PVB108JH8SN rank=0000021 x=3781.0 y=885.0 length=137 40 38 38 30 30 30 38 40 40 30 30 30 36 40 40 40 40 40 40 40 40 40 40 4 +0 39 34 34 14 14 14 14 13 19 14 18 25 32 32 34 27 TGATTATGAGTTAGATGTTCGCTCTGAGGTTTCAACGATGCTTCAAGATTCCTAATTCGCGTTGCGACTC +TCGAGTATGCGTTCTATTCACATTTCTGTTGTCGTACATATTTGACTCACGATCTTGATTTCTTATC >GK9PVB108JYDQ5 rank=0000032 x=3965.0 y=143.0 length=53 25 21 21 23 23 37 31 31 31 37 37 39 38 40 40 40 40 40 40 40 40 39 39 3 +9 39 35 23 25 25 37 34 35 36 37 37 37 37 37 39 39 40 40 40 40 39 38 3 +5 33 33 33 32 31 19 GTTTTCAACGCTGGTTCGAGATTTCCTAATTTCACATTGCGACTCTCGAGTGC

In reply to Re^2: combine 2 fasta files into 1 by Generoso
in thread combine 2 fasta files into 1 by newbie25

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.