Hello toolic, Thank you for that useful code. I found out that my bwa and Input hashes are okay because they share the same key (ID), but hash Amp does not share the same key! so it makes weird data structure like this:

Amp $VAR1 = { 'Seq1Perfect' => [], 'Seq6TruncB' => [], 'Seq7TruncF' => [], 'Seq3In' => [], 'TMEM200B' => [ 'TMEM200B', 'TTTTTTTGTTTGGTTGGTTTTGATTTGAGTGGTTTTTTTGGTG +TTTAGTTTAA GTTGTTTTTGTTGTAGTTTTGTTGTGGGTG +GAGGAGGTTTGGAAGGAGGGGGTGGGTAGGGAGAGGTTGGAGTTGGTGAT + GTTTTTTTTTTTTGTGTTGTGGTATGTAAAGTATAGTAGGGGGGAGGTGGGGTTTGGTG +AGTGATTTTTGTGGATTTGGG AGGTTTGAGTGTTTTTGTT +TTATTTGTTATGGTGTAGTTATGTGTGGGGGTGGGGTTGAGTTTGGGAGGTATTTATTTTG + GAGA' ], 'Seq4Del' => [], 'Seq2MM' => [], 'B3GAT2-2_P001' => [ 'B3GAT2-2_P001', 'GGTTGGTTTTTATTTTTTGGAAGAGTTTTAGATTATAG +GTGTTGTTGT TGTTAGTGAAGAAGAGTATGTTGGGTTGTG +TGTGTTGGTGTTGGTGTTTTTGGTGTAGTTAGGTGAGGTTTGTGTTGTGT + TGTTTAGTGGTGTGTGGTAGTTTGGGTTGTTTGTAGTGTTGTGGTGTGGGTATGTGTAG +GTGAGTGTTGGGTAGTT' ], 'Seq5Partial' => [] };
I will explain again... basically bwa is an alignment program and i already ran bwa so the bwa input file (input file #1 - .sam file) contain both Reference Amplicon ID and Input sequence ID.. Hash 'Amp' contains Reference Amplicon ID and Hash 'Input' contains Input sequence ID.. so a sequence from bwa file will have Reference Amplicon ID AND Input sequence ID both. So you use these two IDs to pick a sequence in Input file #2 (Reference Amplicon ID) and a sequence in Input file #3 (Input sequence ID) and trying to print them so I can compare them later (codes for this comparison is not added yet) Should I create nested foreach to use two different keys? or is there easier way?

In reply to Re^2: Matching strings from three files (three hashes) by FluffyBunny
in thread Matching strings from three files (three hashes) by FluffyBunny

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.