Hello Monks,

I am having a little trouble getting the match regex to work for whatever reason. I have no idea how this isn't working and my head is spinning about it. If you can, could you look at my code and see if you find anything strange about it? Thank you very much!


#! usr/bin/perl -w

use warnings;
use strict;

use Bio::Seq;
use Bio::SeqIO;

#print "What is the filepath of the input file?\n";
my $file = $ARGV[0];
#print "What is the name of the output file?\n";
my $output = $ARGV[1];
my $trash = $ARGV[2];

my $seq_in = Bio::SeqIO->new(-file => $file, -format => "fasta");


open OUTPUT, ">$output";
open TRASH, ">$trash";

my $temp_seq_counter = 0;
my $match_counter = 0;
my $seq;
my $tag_id;
my $position;
my $tag_name;

while(my $seq_obj = $seq_in->next_seq){

    $temp_seq_counter += 1;
    my $temp_seq = $seq_obj->seq;
    my $temp_seq_name = $seq_obj->id;

    my $tag_file = Bio::SeqIO->new(-file => "</home/Alan/Desktop/seque
+nce_data/INFLUENZA_01_07_2010/MIDS.fasta", -format => "fasta");



    while(my $tag_obj = $tag_file->next_seq){

        my $tag = $tag_obj->seq;
        print "tag = ",$tag,"\n";
        my $RC_tag = reverse $tag =~ tr/ACTGactg/TGACtgac/;

        if($temp_seq =~ m/$tag/g || $temp_seq =~ m/$RC_tag/g){

            $position = pos($temp_seq);
            my $length = length($temp_seq);
            
            

                $seq = $seq_obj->subseq($position,$length);
                
                $tag_name = $tag_obj->id;

                $match_counter = 1;
        }

    }

    if($match_counter == 1){
        print OUTPUT ">",$temp_seq_name," Tag: ",$tag_name," ending at
+ ",$position,"\n",$seq,"\n";
    }
    else{

        print TRASH ">",$temp_seq_name," ",$seq_obj->desc,"\n",$temp_s
+eq,"\n";

    }

    $match_counter = 0;

}

print $temp_seq_counter," seqeuences were tested and ",$match_counter,
+" seqeuences have a tag.\n";

close OUTPUT;
close TRASH;

[download]
Sample input:
>GJVIMO101AUT0H length=45 xy=0234_0223 region=1 run=R_2010_07_01_11_09
+_50_
ACGACACGTATACGTGCGTGTCGCGTCTCTCAGCACACAGAGTAG
>GJVIMO101ANKZK length=45 xy=0151_1902 region=1 run=R_2010_07_01_11_09
+_50_
ACGACACGTATCGCGCGCGNGCGCGCGCGCGCGCGCGCGCGCGCG
>GJVIMO101AOIE9 length=41 xy=0162_0179 region=1 run=R_2010_07_01_11_09
+_50_
ACGACACGTATCTCATTGTGCTCAAGGCCTGAGCACAATGA
>GJVIMO101ALCLG length=100 xy=0126_0114 region=1 run=R_2010_07_01_11_0
+9_50_
ACGACACGTATGCTGCTGGTGCTGCTGTAACAGTTCCTGCTGATGCTGCAAGTGCTGCTG
CTGTAACTGTTGCTGCTGTAATCTCTGCTGCTGCTGCTGT

[download]
Pattern to match: 
ACGACACGTAT

[download]

In reply to Regex Match Problem by twaddlac

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.