I use the following snippet from http://www.perlmonks.org/?abspart=1;displaytype=displaycode;node_id=308179;part=1
for parsing fasta format files: Unfortunately, I can't find this script's author. I just modified it slightly to try your problem. 
use strict;
use Data::Dumper;

my ($counter, $line_count, @rec);
{
  local $/ = '>';
  while (<DATA>) {
    
    s/^>//g; # strip out '>' from beginning
    s/>$//g; # and end of line
    next if !length($_);           # ignore empty lines

    my ($header_info) = /^(.*)\n/; # capture the header
    s/^(.*)\n//;                   # and strip it out

    push @rec, $header_info;
    s/\n//mg;                      # join the sequence strings
    $counter++ if $_=~/ACGACACGTAT/;

  }
}

$line_count = scalar @rec;
print "$line_count  seqeuences were tested and $counter seqeuences hav
+e a tag\n";


__DATA__
>GJVIMO101AUT0H length=45 xy=0234_0223 region=1 run=R_2010_07_01_11_09
+_50_
ACGACACGTATACGTGCGTGTCGCGTCTCTCAGCACACAGAGTAG
>GJVIMO101ANKZK length=45 xy=0151_1902 region=1 run=R_2010_07_01_11_09
+_50_
ACGACACGTATCGCGCGCGNGCGCGCGCGCGCGCGCGCGCGCGCG
>GJVIMO101AOIE9 length=41 xy=0162_0179 region=1 run=R_2010_07_01_11_09
+_50_
ACGACACGTATCTCATTGTGCTCAAGGCCTGAGCACAATGA
>GJVIMO101ALCLG length=100 xy=0126_0114 region=1 run=R_2010_07_01_11_0
+9_50_
ACGACACGTATGCTGCTGGTGCTGCTGTAACAGTTCCTGCTGATGCTGCAAGTGCTGCTG
CTGTAACTGTTGCTGCTGTAATCTCTGCTGCTGCTGCTGT
>GJVIMO111ALCLG length=100 xy=0126_0114 region=1 run=R_2010_07_01_11_0
+9_50_
GCTGCTGGTGCTGCTGTAACAGTTCCTGCTGATGCTGCAAGTGCTGCTG
CTGTAACTGTTGCTGCTGTAATCTCTGCTGCTGCTGCTGT

[download]

In reply to Re: Regex Match Problem by umasuresh
in thread Regex Match Problem by twaddlac

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.