Hi, I am a beginner in Perl and I have an exam coming up. I need help with the following question from a past exam paper please.
Given an infile called seqs.fs and containing the following hypothetical FASTA formatted sequences:

>gi|209483500:3405-4275 [Homo sapiens] gene X, complete
ATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTT

>gi|209483501:3307-4262 [Pan paniscus] gene X, complete
AACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACA

>gi|209483502:3600-4187 [Mus musculus] gene X, complete
TAAACACCCTCACCACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACGGATGCT

>gi|209483502:3600-4187 [Canis familiaris] gene X, complete
ATATTTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCCCGATTC

>gi|209483502:3600-4187 [Rattus norvegicus] gene X, complete
CGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTAGCATTACTTATATGATCGATTTT

Write a program that will:
a) Read in seqs.fs and store the sequences in an HASH.
b) Loop through the HASH and write out an alphabetically sorted OUTFILE in which the name of the sequences are reduced to the species name only (the names between square brackets)#
e.g. for the first one we want ">gi|209483500:3405-4275 [Homo sapiens] gene X, complete" reduced to ">Homo sapiens" (could you possibly show me how to do it this way and also if i were searching for a motif in each sequences to just print the title line).
c) Print to STDOUT the GC content of each sequence.
Try to use subroutines if possible.

The GC content is the amount of G's and C's put together.

any help would be greatly appreciated

In reply to Hash help for biologist by utterlyconfused

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.