Why do you want an AOAs? Each sequence is a header + a single, wrapped sequence. Wouldn't a hash be more useful?

#! perl -slw use strict; use Data::Dump qw[ pp ]; my %seqs; { local $/ = ">"; my @seqs = <DATA>; chomp @seqs; s[\n][\t] for @seqs; tr[\n][]d for @seqs; shift @seqs; %seqs = map split( "\t" ), @seqs; } pp \%seqs; __DATA__ >sequence header 1. AAATATTATATATATTGCG ATTATTATATGCGCGGCGC >sequence header 2 AATTGGGCTCGCTGCTTTT AGGAGGAGGAGCCCTCTCC >sequence header 3 AATTGGCTGCTCGCTGCTC AATGTGTCGGCGCGCGTGC

Prints

[ 4:34:55.96] c:\test>junk40 { "sequence header 1." => "AAATATTATATATATTGCGATTATTATATGCGCGGCGC", "sequence header 2" => "AATTGGGCTCGCTGCTTTTAGGAGGAGGAGCCCTCTCC", "sequence header 3" => "AATTGGCTGCTCGCTGCTCAATGTGTCGGCGCGCGTGC", }

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re: Splitting a multi-sequence fasta file into individual sequences in individual arrays by BrowserUk
in thread Splitting a multi-sequence fasta file into individual sequences in individual arrays by krish28

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.