I admit, I didn't think that that was legal. But anyway, the fix is quite trivial and has no affect upon performance:

#! perl -slw
use strict;
use Data::Dump qw[ pp ];

my %sequences;

local $/ = '>';
(undef) = scalar <DATA>; ## Discard first delimiter

local $/ = "\n>";

while( my $record = <DATA> ) {
    my @lines = split "\n", $record;
    pop @lines if $lines[-1] eq '>';
    my $id = shift @lines;
    $sequences{ $id } = join'', @lines;
}
pp \%sequences;

__DATA__
>uc002yje.1 > chr21:13973492-13974491
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaacccggccccgcagagccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
>uc002yje.2 > chr21:13974492-13975432
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG
>uc002yje.3 > chr21:13975431-13976330
cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga
acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga
CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG

[download]

Produces:

C:\test>fasta
{
  "uc002yje.1 > chr21:13973492-13974491" => "cccctgccccaccgcaccctggatt
+actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaacccggccccgcagagc
+cctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG",
  "uc002yje.2 > chr21:13974492-13975432" => "cccctgccccaccgcaccctggatt
+actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaaaaaacccggccccgca
+gagccctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG",
  "uc002yje.3 > chr21:13975431-13976330" => "cccctgccccaccgcaccctggatt
+actgcacgccaagaccctcacctgaacgcgccctacactctggcatgggggaacccggccccgcagagg
+gccctggaCTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG",
}

[download]
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re^3: Bioinformatics: Slow Parsing of a Fasta File by BrowserUk
in thread Bioinformatics: Slow Parsing of a Fasta File by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.