Pre-sorting the data seems like good advice to me,

It is quite the opposite of good advice. Ie very bad advice.

  1. Sorting is O(N logN). The OPs described processing is O(N).

    Sorting does not help the OPs processing at all.

  2. FASTA file are multi-line record format files.

    If you sorted a FASTA file with the system sort utility, it would screw the file up in a completely irrecoverable way.

    Eg. This:

    c:\test>type 845226.fasta >uc002yje.1 chr21:13973492-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaacccggccccgcagagccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG >uc002yje.1 chr21:13973492-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG >uc002yje.1 chr21:13973492-13976330 cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG

    becomes this:

    c:\test>sort 845226.fasta >uc002yje.1 chr21:13973492-13976330 >uc002yje.1 chr21:13973492-13976330 >uc002yje.1 chr21:13973492-13976330 acgcgccctacactctggcatgggggaaaaaacccggccccgcagagccctgga acgcgccctacactctggcatgggggaacccggccccgcagagccctgga acgcgccctacactctggcatgggggaacccggccccgcagagggccctgga cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga cccctgccccaccgcaccctggattactgcacgccaagaccctcacctga CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG CTCTGACATTGGAGGACTCCTCGGCTACGTCCTGGACTCCTGCACAAGAG

    And so is rendered entirely useless.


Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re^4: remove part of string (DNA) ... More off-topic by BrowserUk
in thread remove part of string (DNA) by Furor

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.