I found out I didn't set the path for my file correctly. Thanks for the suggest. My sort is working now. Great! The next step is to extract unique sequence from the list and keep the IDs for each unique sequence. Any suggestion to do this? Thanks, Sample sequence in a file. There are 120,000 sequences in one file: 

>11EZ4_FR1a_3LNSF7V
ACCTCTGGCTTCACCTTTACCAACTATGCCATGACCTGGGTCCGCCAGACTCCAGGGAAGGGCCTGGAGT
+GGCTTTCAG

GCATTAGTGGTGGTGGTGATATCATACACTATGCAGACTTCGTGAAGGGCCGGTTCACCGTCTCCAGAGA
+CGATTCTAA

GAGCACACTGTTTCTGCAAATGACCGGCCTGAGAGCCGAAGACTCGGCCGTGTATTATTGTGCGAGAAGG
+CGTGTACGT

CAGGGAGGCACCTACTACTACTACATGGACTTCTGGGGCAAAGGGACCACG

[download]

In reply to Re^2: sort sequences and keep ID of them by Diane4Luo
in thread sort sequences and keep ID of them by Diane4Luo

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.