I am new to perl I want to count the occurance of gene ID's in a file like under; I simply want to count how many Glyma05g00620.1|PACid:16257864 etc are these in my file. 

@SQ    SN:Glyma0095s00250.1|PACid:16242825    LN:445
@SQ    SN:Glyma0142s00240.1|PACid:16242871    LN:472
@PG    ID:Bowtie    VN:0.12.6    CL:"./bowtie --best --sam Gmax /Users
+/waseem/Desktop/inputdata/s_4_sequence_S21A.txt /Users/waseem/Desktop
+/Outputs/s_4_sequence_S21Aoutput.sam"
DBRHHJN1_0134:4:1:1203:1044#ATCACG/1    16    Glyma05g00620.1|PACid:16
+257864    324    255    100M    *    0    0    CGCCGACATCTCGGGGCTCACC
+CCATGCAAGGAGTCGAAGCAGTTCGCGAAGCGTGAGAAGCAGTCGATAAAGAAGCTGGAGTCGTCGCTG
+AAGCTCCAC    BBBBBBBB`dcceeeddcc\cccc`ZbabYedaddadeceb_bc^^eaggdgddbg
+ggeegggggeggggggggggfgggeggggggegggggggggggg    XA:i:1    MD:Z:97T2  
+  NM:i:1
DBRHHJN1_0134:4:1:1808:1025#ATCACG/1    16    Glyma12g03760.1|PACid:16
+286293    1740    255    100M    *    0    0    TAATAAATGGACATCACTGGC
+CTTAATGGTGTATCGTGAAACAATTGAAGCCGGTGGAAAACCTACAAGTGAAATATTACCACAAATTCT
+GGGATGCCTG    BBBB__YT]OY]]M\Yccc`\]`Za[Vda``[dbdeb]febec^e_^gggffffd
+gggggggggggggggffffffggeggggggggfggggggggfggg

[download]

In reply to How to make a Counter by alvi

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.