Hi! I have a huge text file (around 10GB) of DNA sequences in the following format which is composed by four lines (the DNA sequence is always in the line before the "+" sing):

@HWI-ST591:68:D0DBPABXX:5:1101:1197:2084 1:N:0:

GGTAGTTCGACCGTGGAT

+

B@@FFEFFHDHHFHIJJE

@HWI-ST591:68:D0DBPABXX:5:1101:1086:2085 1:N:0:

GCTGGAACTTGGCAAAGAAGAGAG

+

@@@FFEFFGHHHH@@FEHBEHJGG

I need to write a perl script to read the sequence lines and print their length which can vary between 0 and 100 positions. My main problem is that I don't know how to write in perl the command line to read each four lines and calculate the length of the second one. I would be very grateful if someone could help me! Thanks!

In reply to read nth lines in a text file by adansonia

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.