Dear perl monks I have the following code , and the result that I would expect is 1 while it should be 3. Any idea what I am doing wrong? Also is there any easy way to count the letters between each time it finds the substring and store them in an array? Thanks in advance for your help. 

#!/usr/bin/perl
use warnings;
use strict;


open (FILE,"sequence.txt");


my $substring = 'GATC';
my$i=0;
my$count;
my $sequence;

while ($sequence=<FILE>){
    
    foreach($sequence =~ /$substring/) { 
   #print "malakas\n";
            
            #print "$count\n";
    }
    $count++; 
}
    print "There are $count negative numbers in the string";

[download]

here is whats in the sequence.txt file: GAGAGACCCCGATCGAGAGACCCGATCFGAGAVCTGATCCCC

In reply to stupid/simple mistake by gogoglou

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.