What would be the most efficient way of merging two almost identical strings?

I have two dna sequences as strings, for example:

$string1:

AYGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTTA

$string2:

ACGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTKA

$string1 has an ambiguous base on the second character (Y) and $string2 has an ambiguous base on the 52nd character (K). Ambiguous bases can be denoted within the string by the following characters RYSWKMBDHV.

I want to be able to merge multiple DNA strings so that the nucleotide sequences are conserved, except where an ambiguous base occurs, so in the above example I would get a new string that looked like:

$new_string:

AYGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTKA

So the new string contains both the ambiguous base at position 2 and position 52.

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.