would this still work for more than 2 strings

As long as the ambiguous bases are in distinct positions, yes.

In the general case, you can then write: 

my @s = (
    "AYGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTTA",
    "ACGTACTAGACTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTKA",
    "ACGTACTAGWCTACAGACTACAGACATCTACAGACTCATCAGCAGCATATTTA",
    "ACGTACTAGACTACAGACTACAGMCATCTACAGACTCATCAGCAGCATATTTA",
    "ACGTACTAGACTACAGACTACAGACATCTACAGACTCATRAGCAGCATATTTA",
    # ...
);

my $m = shift @s;
for my $s (@s) {
    my $m_ = $m;  $m_ =~ tr/ACGT/\0/c;
    my $s_ = $s;  $s_ =~ tr/ACGT/\0/c;
    $m = $m ^ $m_ ^ $s ^ $s_ | $m_ & $s_;  
}
say $m;   # AYGTACTAGWCTACAGACTACAGMCATCTACAGACTCATRAGCAGCATATTKA
             ^       ^             ^               ^           ^

[download]

(P.S., sorry — meant to reply to garyboyd... )

In reply to Re^4: merging dna sequences by Eliya
in thread merging dna sequences by garyboyd

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.