Consider a function that given an RNA sequence string, returns a string representing the corresponding amino acids. RNA is represented as string of letters A, C, G, and U, representing the base pairs Adenine, Cytosine, Guanine, and Uracil respectively. This differs from DNA in that Uracil replaces Thymine, which is why this is AC GU instead of the familiar AC GT (i.e. 'GATTACA'). The amino acids are also represented by a single letter.

As an example, the string 'UUCGAACACUGAG' would be transformed into 'FEH.' and returned.

RNA works such that each group of three "letters" (i.e. base-pairs) corresponds to the use of a particular amino acid, or the STOP sequence which is represented here as a period. If there are one or two extra letters at the end of the sequence, these should be ignored. All input to the function is assumed to contain only the letters A,C,G,U, and nothing else, though the number of characters may be arbitrary.


Below is a reference implementation that is not optimized, and includes comments for the curious: 
sub f {
my %g = (
        # . - Stop
        'UAA'=>'.','UAG'=>'.','UGA'=>'.',
        # A - Alanine
        'GCU'=>'A','GCC'=>'A','GCA'=>'A','GCG'=>'A',
        # C - Cysteine
        'UGU'=>'C','UGC'=>'C',
        # D - Aspartic Acid
        'GAU'=>'D','GAC'=>'D',
        # E - Glutamic Acid
        'GAA'=>'E','GAG'=>'E',
        # F - Phenylalanine
        'UUU'=>'F','UUC'=>'F',
        # G - Glycine
        'GGU'=>'G','GGC'=>'G','GGA'=>'G','GGG'=>'G',
        # H - Histidine
        'CAU'=>'H','CAC'=>'H',
        # I - Isoleucine
        'AUU'=>'I','AUC'=>'I','AUA'=>'I',
        # K - Lysine
        'AAA'=>'K','AAG'=>'K',
        # L - Leucine
        'CUU'=>'L','CUC'=>'L','CUA'=>'L','CUG'=>'L',
        'UUA'=>'L','UUG'=>'L',
        # M - Methionine
        'AUG'=>'M',
        # N - Asparagine
        'AAU'=>'N','AAC'=>'N',
        # P - Proline
        'CCU'=>'P','CCC'=>'P','CCA'=>'P','CCG'=>'P',
        # Q - Glutamine
        'CAA'=>'Q','CAG'=>'Q',
        # R - Arginine
        'CGU'=>'R','CGC'=>'R','CGA'=>'R','CGG'=>'R',
        'AGA'=>'R','AGG'=>'R',
        # S - Serine
        'UCU'=>'S','UCC'=>'S','UCA'=>'S','UCG'=>'S',
        'AGU'=>'S','AGC'=>'S',
        # T - Threonine
        'ACU'=>'T','ACC'=>'T','ACA'=>'T','ACG'=>'T',
        # V - Valine
        'GUU'=>'V','GUC'=>'V','GUA'=>'V','GUG'=>'V',
        # W - Tryptophan
        'UGG'=>'W',
        # Y - Tyrosine
        'UAU'=>'Y','UAC'=>'Y',
);
$_=pop;s/.{1,3}/$g{$&}/g;$_
}

print f("ACCCACAUUUCAUAAAUAUCCCCUGAGCGGCUCUGAGGGCAACUGUUCUAAUC");

[download]
Interesting Links: Genetic Code, Golf challange: match U.S. State names
Update: Typo in the example 'GAG'->'CAC' fixed.

In reply to (Golf) RNA Genetic Code Translator by tadman

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.