Assuming that you are storing your sequences in files with meaningful names you could do something like this. Given these two example sequence files

knoppix@Microknoppix:~/perl/Monks$ head -99 spw961600_seq*
==> spw961600_seqA <==
TCCAGATCCCTGGGGCCCCTGGGTGAGGGCAGCCAGACGCAACGTCTGGAGGAAGCT

==> spw961600_seqB <==
CTGCGTTTCGACGCCATGGCTGAGCTGGAGACGGTCCTGCCCATGCTGCTC
knoppix@Microknoppix:~/perl/Monks$
[download]

this script

use strict;
use warnings;

use Data::Dumper;

my @seqFiles = glob q{spw961600_seq*};
my %counts;

foreach my $seqFile ( @seqFiles )
{
    my $seq = do {
       open my $seqFH, q{<}, $seqFile
          or die qq{open: < $seqFile: $!\n};
       local $/;
       <$seqFH>;
       };
    while ( $seq =~ m{(?=(..))}g )
    {
        $counts{ totals }->{ $1 } ++;
        $counts{ $seqFile }->{ $1 } ++;
    }
}

print Data::Dumper->Dumpxs( [ \ %counts ], [ qw{ *counts } ] );
[download]

builds this data structure

%counts = (
            'spw961600_seqB' => {
                                  'AC' => 2,
                                  'AG' => 2,
                                  'CC' => 4,
                                  'TG' => 7,
                                  'AT' => 2,
                                  'TC' => 3,
                                  'GA' => 4,
                                  'TT' => 2,
                                  'CT' => 6,
                                  'GG' => 3,
                                  'CG' => 4,
                                  'CA' => 2,
                                  'GC' => 7,
                                  'GT' => 2
                                },
            'spw961600_seqA' => {
                                  'AC' => 2,
                                  'AG' => 6,
                                  'CC' => 7,
                                  'TG' => 4,
                                  'AT' => 1,
                                  'TC' => 3,
                                  'AA' => 2,
                                  'GA' => 5,
                                  'CT' => 4,
                                  'CG' => 2,
                                  'GG' => 9,
                                  'GC' => 5,
                                  'CA' => 4,
                                  'GT' => 2
                                },
            'totals' => {
                          'AC' => 4,
                          'AG' => 8,
                          'CC' => 11,
                          'TG' => 11,
                          'AT' => 3,
                          'TC' => 6,
                          'AA' => 2,
                          'GA' => 9,
                          'TT' => 2,
                          'CT' => 10,
                          'CG' => 6,
                          'GG' => 12,
                          'GC' => 12,
                          'CA' => 6,
                          'GT' => 4
                        }
          );
[download]

I hope I have understood your question correctly and that this will help you move forward.

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.