PLEASE HELP!! Evey way I attempt to do this I am not successful!

I and trying to extract the sequence in between two primers. For example if my primers are ATGAA and TGCCG, and the sequence is AATCGGGTATGAAAAATTTTGCCGGCGTTTGCG I want to get AAAATTT,

I tried this by using split() by the first primer save value then split() by the second primer, but some sequence have multiple ATGG or TGCCG at it splits to many times

So I tried it using the m// function, something like 

$seq=~ m/.*ATGAA.*?TGCCG.*/;  
$match=$_;

[download]

but this isn't working either!! I know there is a simple way, but I can't seem to find a helpful function!! Any help would be greatly appreciated!

In reply to Finding patterns by MoniqueLT

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.