... primers are ATGAA and TGCCG, and the sequence is AATCGGGTATGAAAAATTTTGCCGGCGTTTGCG I want to get AAAATTT ...

... some sequence have multiple ATGG or TGCCG ...

MoniqueLT: I am a bit confused between ATGAA, ATGA and ATGG, but I will assume that in your example you wanted to extract AAAATTT ultimately. The example below shows one approach of many possible. Of course, this approach does not provide positional information on the matches, which I suspect you will ultimately need. Please post a follow-up in this thread if match position information is needed.

In addition to perlre, see perlretut and perlrequick and the Regex section of this site's Tutorials. 

>perl -wMstrict -le
"my $seq =
   'AATCGGGTATGAAAAATTTTGCCGGCGTTTGCGATGAATATATTGCCGGAGAGA';
 ;;
 my $prime1 = 'ATGA';
 my $prime2 = 'TGCCG';
 ;;
 my @subseqs = $seq =~ m{ $prime1 (.*?) $prime2 }xmsg;
 printf qq{'$_' } for @subseqs;
"
'AAAATTT' 'ATATAT'

[download]

Update: What the heck – positional info is simple enough, here's an approach. See  @- and  @+ in perlvar. 

>perl -wMstrict -le
"my $seq =
   'AATCGGGTATGAAAAATTTTGCCGGCGTTTGCGATGAATATATTGCCGGAGAGA';
 ;;
 my $prime1 = 'ATGA';
 my $prime2 = 'TGCCG';
 ;;
 while ($seq =~ m{ $prime1 (.*?) $prime2 }xmsg) {
   printf qq{matched '%s' at %d thru %d \n}, $1, $-[1], $+[1]-1;
   }
"
matched 'AAAATTT' at 12 thru 18
matched 'ATATAT' at 37 thru 42

[download]

In reply to Re: Finding patterns by AnomalousMonk
in thread Finding patterns by MoniqueLT

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.